IP Library Granted Patent US 12662516
Granted Patent B2
US 12662516 · App. 17/764,497 · Granted Jun 23, 2026

DNA binding proteins for displacing endogenous transcription factors bound to gene regulatory regions

Inventors: Jennifer M. Cherone (Seattle, WA); Alister PW Funnell (Seattle, WA); John A. Stamatoyannopoulos (Seattle, WA)
Assignee: Altius Institute for Biomedical Sciences
C07K14/4702A61P7/06C07K14/805A61K38/00C07K2319/80
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 12662516
App. No.
17/764,497
Granted
Jun 23, 2026
Kind
B2
Abstract

The present disclosure provides methods and compositions for modulating expression of a target gene in a cell by reducing binding of an endogenous transcription factor to a regulatory sequence of the target gene. The method includes introducing into the cell a DNA binding polypeptide (DBF) that binds a sequence in regulatory region of a target gene bound by a transcription factor (TF), thereby displacing the TF and modulating expression of the target gene. The DBF may be designed to bind a sequence comprising the binding site for the TF and additional nucleotides present on one or both sides of the sequence. Accordingly, the DBF specifically binds to binding site for the TF in the target gene but not in other genes that are also regulated by binding of the TF but do not include the nucleotides present on one or both sides of the sequence.

Claims (40)

1 . A nucleic acid encoding a recombinant DNA binding polypeptide (DBP) comprising a plurality of repeat units (RUs) ordered from N-terminus to C-terminus of the DBP to bind to a nucleic acid sequence in the fetal y-globin gene promoter, wherein the sequence is

(SEQ ID NO: 1)

CCTCTTGGGGGCCCC

or

(SEQ ID NO: 2)

ATCCTCTTGGGGGCCCC,

wherein each of the RU comprises the amino acid sequence X 1-11 X 12 X 13 X 14-33, 34, or 35 (SEQ ID NO: 4), wherein:

X 1-11 is a chain of 11 contiguous amino acids,

X 14-33 or 34 or 35 is a chain of 20, 21 or 22 contiguous amino acids,

X 12 X 13 is selected from:

(a) NH, HH, KH, NK, NQ, RH, RN, SS, NN, SN, or KN for recognition of guanine (G);

(b) NI, KI, RI, HI, or SI for recognition of adenine (A);

(c) NG, HG, KG, or RG for recognition of thymine (T);

(d) HD, RD, SD, ND, KD, or YG for recognition of cytosine (C); and

(e) NV or HN for recognition of A or G; and (f)H*, HA, KA, N*, NA, NC, NS, RA, or S* for recognition of A or T or G or C, wherein (*) means that the amino acid at X 13 is absent,

wherein the DBP is not fused to a functional domain having cleavage activity,

wherein the DBP is not fused to a functional domain having transcriptional activation activity, and

wherein binding of the DBP to the fetal γ-globin gene promoter results in expression of fetal hemoglobin-γ (HBG) from the fetal γ-globin gene.

2 . The nucleic acid of claim 1 , wherein the X 12 X 13 in the RUs from N-terminus to C-terminus are HD, HD, NG, HD, NG, NG, NH, NH, NH, NH, NH, HD, HD, HD, and HD, wherein the last RU is a half-RU.

3 . The nucleic acid of claim 1 , wherein the DBP binds to the nucleic acid sequence: ATCCTCTTGGGGGCCCC (SEQ ID NO: 2).

4 . The nucleic acid of claim 3 , wherein the X 12 X 13 in the RUs from N-terminus to C-terminus are NI, NG, HD, HD, NG, HD, NG, NG, NH, NH, NH, NH, NH, HD, HD, HD, and HD, wherein the last RU is a half-RU.

5 . The nucleic acid of claim 1 , wherein the DBP binds to the nucleic acid sequence: CCTCTTGGGGGCCCCTTCCC (SEQ ID NO: 3).

6 . The nucleic acid of claim 5 , wherein the X 12 X 13 in the RUs from N-terminus to C-terminus are HD, HD, NG, HD, NG, NG, NH, NH, NH, NH, NH, HD, HD, HD, HD, NG, NG, HD, HD, and HD, wherein the last RU is a half-RU.

7 . The nucleic acid of claim 1 , wherein

X 1-11 is at least 80% identical to LTPEQVVAIAS (SEQ ID NO: 6), LTPAQVVAIAS (SEQ ID NO: 9), LTPDQVVAIAN (SEQ ID NO: 10), LTPDQVVAIAS (SEQ ID NO: 11), LTPYQVVAIAS (SEQ ID NO: 12), LTREQVVAIAS (SEQ ID NO: 13), or LSTAQVVAIAS (SEQ ID NO: 14), and

the chain of 20, 21, or 22 contiguous amino acids is at least 80% identical to GGKQALETVQRLLPVLCQDHG (SEQ ID NO: 15), GGKQALATVQRLLPVLCQDHG (SEQ ID NO: 16), GGKQALETVQRVLPVLCQDHG (SEQ ID NO: 17.

8 . The nucleic acid of claim 7 , wherein the DBP protein comprises an N-terminal domain comprising an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 150, 18, 19, or 20, and

wherein the chain of 7, 8 or 9 contiguous amino acids is at least 80% identical to GGRPALE (SEQ ID NO: 7).

9 . The nucleic acid of claim 1 , wherein the nucleic acid is operably linked to a promoter sequence that confers expression of the DBP or wherein the sequence of the nucleic acid is codon optimized for expression of the DBP in a human cell.

10 . The nucleic acid of claim 1 , wherein the nucleic acid is a deoxyribonucleic acid (DNA).

11 . The nucleic acid of claim 1 , wherein the nucleic acid is a ribonucleic acid (RNA).

12 . A viral vector comprising the nucleic acid of claim 1 .

13 . A host cell that comprises the nucleic acid of claim 1 and expresses the DBP.

14 . The host cell of claim 13 , wherein the cell is a pluripotent stem cell, an induced pluripotent stem cell, a hematopoietic progenitor cell, or an erythroid progenitor.

15 . A pharmaceutical composition comprising the nucleic acid of claim 1 and a pharmaceutically acceptable excipient.

16 . A pharmaceutical composition comprising the host cell of claim 14 .

17 . A method for increasing expression of fetal hemoglobin-γ (HBG) in a subject in need thereof, the method comprising administering to the subject the pharmaceutical composition of claim 16 , wherein the subject has sickle cell anemia or thalassemia.

18 . The nucleic acid of claim 1 , wherein the nucleic acid sequence in the fetal γ-globin gene promoter bound by the DBP comprises a 5′ T.

19 . The nucleic acid of claim 1 , wherein the DBP comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO:156.

20 . The nucleic acid of claim 8 , wherein the nucleic acid sequence in the fetal γ-globin gene promoter bound by the DBP comprises a 5′ T.