IP Library › Granted Patent US 12662669
Granted Patent B2
US 12662669 · App. 18/362,190 · Granted Jun 23, 2026

RAAV-based compositions and methods for treating amyotrophic lateral sclerosis

Inventors: Christian Mueller (Worcester, MA); Robert H. Brown, Jr. (Worcester, MA)
Assignee: University of Massachusetts
C12N15/113C12N15/111C12N15/1137C12N15/86C12Y115/01001C12N2310/14C12N2310/141C12N2320/32C12N2330/51C12N2750/14143
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 12662669
App. No.
18/362,190
Granted
Jun 23, 2026
Kind
B2
Abstract

The invention relates to inhibitory nucleic acids and rAAV-based compositions, methods and kits useful for treating Amyotrophic Lateral Sclerosis.

Claims (23)

1 . A method of treating a subject having or suspected of having ALS, the method comprising:

administering to the subject an effective amount of a recombinant adeno-associated virus (rAAV) harboring a nucleic acid that is engineered to express, in a cell of the subject, a miRNA that targets RNA encoded by a SOD1 gene,

wherein the miRNA comprises 21 continuous nucleotides encoded by a sequence set forth in SEQ ID NO: 17: CTGCATGGATTCCATGTTCAT (SOD-miR-127),

wherein the rAAV comprises an AAV.Rh10 capsid protein.

2 . The method of claim 1 , wherein the rAAV targets CNS tissue.

3 . The method of claim 1 , wherein the rAAV is administered intrathecally, intracerebrally, intraventricularly or intravenously.

4 . The method of claim 1 , wherein the microRNA further comprises flanking regions of miR-155.

5 . The method of claim 1 , wherein the nucleic acid further comprises AAV2 inverted terminal repeats (ITRs).

6 . The method of claim 1 , wherein the nucleic acid further comprises a promoter operably linked with a region(s) encoding the miRNA.

7 . The method of claim 6 , wherein the promoter is a tissue-specific promoter.

8 . The method of claim 7 , wherein the promoter is a polymerase II promoter or a polymerase III promoter.

9 . A recombinant nucleic acid comprising a sequence set forth in 21 consecutive nucleotides of SEQ ID NO: 17, flanking regions of miR-155, and further comprising an inverted terminal repeat (ITR) of AAV2.

10 . The recombinant nucleic acid of claim 9 , further comprising a promoter operably linked with a region(s) encoding the miRNA.

11 . The recombinant nucleic acid of claim 10 , wherein the promoter is a tissue-specific promoter.

12 . The recombinant nucleic acid of claim 11 , wherein the promoter is a polymerase II promoter.

13 . The recombinant nucleic acid of claim 11 , wherein the promoter is a polymerase III promoter.

14 . A composition comprising the recombinant nucleic acid of claim 9 .

15 . A recombinant Adeno-Associated Virus (AAV) comprising a recombinant nucleic acid encoding a miRNA comprising 21 consecutive nucleotides encoded by a sequence as set forth in SEQ ID NO: 17, flanking regions of miR-155, and further comprising a capsid protein of AAV.Rh10.

16 . The recombinant AAV of claim 15 , wherein the recombinant nucleic acid comprises an inverted terminal repeat (ITR) of AAV2.

17 . The recombinant AAV (rAAV) of claim 15 , wherein the rAAV is formulated for administration intrathecally, intracerebrally, intraventricularly or intravenously.

18 . A composition comprising the recombinant AAV of claim 15 .

19 . The composition of claim 18 , further comprising a pharmaceutically acceptable carrier.

20 . A kit comprising a container comprising the composition of claim 18 .