Methods of treatment with aminolevulinic acid synthase 2 (ALAS2) modulators
Described herein is a compound of Formula I or a pharmaceutically acceptable salt thereof: wherein Ring A R 1 , R 2 , a, b, and n are as defined herein. Also described is a method of treating a subject having a disorder in need of treatment, comprising inhibiting aminolevulinic acid synthase 2 (ALAS2) in the subject by administering a compound of Formula (I) or a pharmaceutically acceptable salt thereof. Disorders that are of particular interest are blood disorders, such as porphyria and anemia.
1 . A mouse ( Mus musculus ) as an animal model for X-linked protoporphyria (XLP), wherein the mouse comprises a genomic ALAS2 (5-AminoLevulinic Acid Synthase 2)-delAT mutation at the mouse ALAS2 locus comprising the genomic DNA sequence of SEQ ID NO: 5, wherein the mouse has an elevated level of blood protoporphyrin IX (PPIX) and Zn-PPIX compared to a syngeneic wild-type mouse, and wherein the genomic ALAS2-delAT mutation encodes a mutant ALAS2 protein comprising an M567E substitution followed by a C-terminal deletion, and corresponds to or recapitulates the human ALAS2-delAT (c.1699_1670ΔAT) mutation in an XLP human patient.
2 . The mouse of claim 1 , which is a C57BL/6 mouse.
3 . The mouse of claim 1 , which is a male (ALAS2 delAT/Y ).
4 . The mouse of claim 1 , which is a female.
5 . The mouse of claim 4 , which is homozygous for the genomic ALAS2-delAT mutation (ALAS2 delAT/delAT ).
6 . The mouse of claim 4 , which is heterozygous for the genomic ALAS2-delAT mutation.
7 . The mouse of claim 1 , which is generated by CRISPR/Cas9-mediated homology-directed repair (HDR) that deletes the AT dinucleotide in the genomic ALAS2-delAT mutation.
8 . The mouse of claim 7 , wherein the CRISPR/Cas9-mediated HDR utilizes a single guide RNA (sgRNA) comprising the nucleotide sequence of SEQ ID NO: 4.
9 . The mouse of claim 7 , wherein the CRISPR/Cas9-mediated HDR utilizes a donor DNA having the polynucleotide sequence of SEQ ID NO: 5.
10 . The mouse of claim 7 , wherein the CRISPR/Cas9-mediated HDR is carried out by microinjecting into the pronucleus of a mouse zygote an mRNA encoding Cas9, an sgRNA, and a single-stranded DNA (ssDNA).
11 . The mouse of claim 1 , wherein the mouse further comprises (i) at least one expression cassette comprising a polynucleotide encoding a reverse tetracycline-controlled transactivator (rtTA) under transcriptional control of a Rosa26 promoter and (ii) at least one expression cassette comprising a polynucleotide encoding an ALAS2 shRNA sequence (shALAS2) under transcriptional control of a TRE promoter.
12 . The mouse of claim 11 , wherein the expression cassette comprising a polynucleotide encoding an rtTA is inserted into chromosome 6.
13 . The mouse of claim 11 , wherein the expression cassette comprising a polynucleotide encoding shALAS2 is inserted into chromosome 11 at the ColA1 locus.
14 . The mouse of claim 11 , wherein the mouse is heterozygous for the ALAS2-delAT mutation, heterozygous for rtTA (rtTA+/−) and heterozygous for shALAS2 (shALAS2+/−).
15 . The mouse of claim 11 , wherein the shALAS2 comprises the sequence UGAAAAAUUGGUCAUAACCGAA (SEQ ID NO: 6).