CRISPR-cas effector polypeptides and methods of use thereof
The present disclosure provides variant CRISPR-Cas effector polypeptides, as well as engineered guide nucleic acids, and systems comprising the same. The present disclosure provides methods of modifying a target nucleic acid, using a variant CRISPR-Cas effector polypeptide of the present disclosure.
1 . A variant CRISPR-Cas effector polypeptide comprising an amino acid sequence having at least 85% amino acid sequence identity to SEQ ID NO: 1, wherein the variant CRISPR-Cas effector polypeptide comprises a substitution of the sequence NSNSTEFKSYKSGKQPFVGAWQA (SEQ ID NO:34) of the reference CRISPR-Cas effector polypeptide set forth as SEQ ID NO: 2,
wherein said substitution provides for increased binding and/or cleavage of a target nucleic acid compared to the binding and/or cleavage of the target nucleic acid by the reference CRISPR-Cas effector polypeptide.
2 . The variant CRISPR-Cas effector polypeptide of claim 1 , wherein the variant CRISPR-Cas effector polypeptide exhibits at least 2-fold increased target cleavage of a target nucleic acid compared to the cleavage of the target nucleic acid by the reference CRISPR-Cas effector polypeptide.
3 . The variant CRISPR-Cas effector polypeptide of claim 1 , the amino acid sequence X 1 SQEYKX 2 YX 3 X 4 X 5 KTTGNTDKX 6 X 7 FVX 8 X 9 WQX 10 (SEQ ID NO:31), where X 1 is Arg, Gln, or Asn; X 2 is Lys, His, or Ser; X 3 is Gln, Arg, or Asn; X 4 is Thr or Ser; X 5 is Arg, Asn, Gln, or Gly; X 6 is Arg, Gln, or Asn; X 7 is Ala, Val, or Pro; X 8 is Glu, Asp, or Gly; X 9 is Thr, Ser, Ala, or Val; and X 10 is Ser, Thr, Ala, or Val, replaces the sequence NSNSTEFKSYKSGKQPFVGAWQA (SEQ ID NO:34).
4 . The variant CRISPR-Cas effector polypeptide of claim 1 , wherein the amino acid sequence RSQEYKKYQTNKTTGNTDKRAFVETWQS (SEQ ID NO:30) replaces the sequence NSNSTEFKSYKSGKQPFVGAWQA (SEQ ID NO:34).
5 . The variant CRISPR-Cas effector polypeptide of claim 1 , wherein the variant CRISPR-Cas effector polypeptide is a nickase that can cleave only one strand of a double-stranded target nucleic acid.
6 . The variant CRISPR-Cas effector polypeptide of claim 1 , wherein the variant CRISPR-Cas effector polypeptide is catalytically inactive.
7 . The variant CRISPR-Cas effector polypeptide of claim 1 , wherein the variant CRISPR-Cas effector polypeptide comprises one or more mutations at a position corresponding to D672, E769, and/or D935 of SEQ ID NO: 1.
8 . A composition comprising:
a) a variant CRISPR-Cas effector polypeptide of claim 1 , or a nucleic acid comprising a nucleotide sequence encoding the variant CRISPR-Cas effector polypeptide; and
b) a guide nucleic acid, or a nucleic acid comprising a nucleotide sequence encoding the guide nucleic acid, wherein the guide nucleic acid comprises: i) an activator region that can bind to and activate the variant CRISPR-Cas effector polypeptide; and ii) a guide sequence that can hybridize with a target region of a target nucleic acid,
optionally wherein the activator region comprises one or more modifications as set out in Table 1, compared to the following the nucleotide sequence:
(SEQ ID NO: 10)
GGCGCGUUUAUUCCAUUACUUUGGAGCCAGUCCCAGCGAC
UAUGUCGUAUGGACGAAGCGCUUAUUUAUCGGAGAGAAAC
CGAUAAGUAAAACGCAUCAAAG.
9 . The composition of claim 8 , wherein the guide nucleic acid comprises the nucleotide sequence:
(SEQ ID NO: 90)
GGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAUGUCGU
AUGGGUAAAGCGCUUAUUUAUCGGAGAAACCGAUAAAUAAGAAGCAUCA
AAG(N x ),
wherein N is any nucleotide and x is an integer from 19 to 30.
10 . The composition of claim 8 , wherein the guide RNA is a single-molecule guide RNA.
11 . The composition of claim 8 , wherein the composition comprises a lipid.
12 . The composition of claim 8 , wherein a) and b) are within a liposome.
13 . The composition of claim 8 , wherein a) and b) are within a particle.
14 . The composition of claim 8 , comprising one or more of: a buffer, a nuclease inhibitor, and a protease inhibitor.
15 . The composition of claim 8 , comprising a DNA donor nucleic acid.
16 . A nucleic acid comprising a nucleotide sequence encoding the variant CRISPR-Cas effector polypeptide of claim 1 .
17 . The nucleic acid of claim 16 , wherein the nucleotide sequence is operably linked to a promoter.
18 . The nucleic acid of claim 17 , wherein the promoter is functional in a eukaryotic cell.
19 . The nucleic acid of claim 18 , wherein the promoter is functional in one or more of: a plant cell, a fungal cell, an animal cell, cell of an invertebrate, a fly cell, a cell of a vertebrate, a mammalian cell, a primate cell, a non-human primate cell, and a human cell.
20 . The nucleic acid of claim 17 , wherein the promoter is one or more of: a constitutive promoter, an inducible promoter, a cell type-specific promoter, and a tissue-specific promoter.
21 . A recombinant expression vector comprising the nucleic acid of claim 16 .
22 . The recombinant expression vector of claim 21 , wherein the recombinant expression vector is a recombinant adenoassociated viral vector, a recombinant retroviral vector, or a recombinant lentiviral vector.
23 . A fusion polypeptide comprising:
a) a variant CRISPR-Cas effector polypeptide of claim 1 ; and
b) one or more heterologous polypeptides.
24 . The fusion polypeptide of claim 23 , wherein the variant CRISPR-Cas effector polypeptide is a nickase that can cleave only one strand of a double-stranded target nucleic acid.
25 . The fusion polypeptide of claim 23 , wherein the variant CRISPR-Cas effector polypeptide is catalytically inactive.
26 . The fusion polypeptide of claim 24 , wherein the variant CRISPR-Cas effector polypeptide comprises one or more mutations at a position corresponding to D672, E769, and/or D935 of SEQ ID NO: 1.
27 . The fusion polypeptide of claim 23 , wherein the heterologous polypeptide is fused to the N-terminus and/or the C-terminus of the variant CRISPR-Cas effector polypeptide.
28 . The fusion polypeptide of claim 23 , wherein at least one of the one or more heterologous polypeptides is a nuclear localization signal.
29 . The fusion polypeptide of claim 23 , wherein the one or more heterologous polypeptides is a targeting polypeptide that provides for binding to a cell surface moiety on a target cell or target cell type.
30 . The fusion polypeptide of claim 23 , wherein the one or more heterologous polypeptides exhibits an enzymatic activity that modifies target DNA.
31 . The fusion polypeptide of claim 30 , wherein the heterologous polypeptide exhibits an enzymatic activity selected from: nuclease activity, methyltransferase activity, demethylase activity, DNA repair activity, DNA damage activity, deamination activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer forming activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photolyase activity and glycosylase activity.
32 . The fusion polypeptide of claim 30 , wherein the heterologous polypeptide exhibits an enzymatic activity selected from: nuclease activity, methyltransferase activity, demethylase activity, deamination activity, depurination activity, integrase activity, transposase activity, and recombinase activity.
33 . The fusion polypeptide of claim 23 , wherein the heterologous polypeptide exhibits an enzymatic activity that modifies a target polypeptide associated with a target nucleic acid.
34 . The fusion polypeptide of claim 33 , wherein the heterologous polypeptide exhibits histone modification activity.
35 . The fusion polypeptide of claim 33 , wherein the heterologous polypeptide exhibits an enzymatic activity selected from: methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin ligase activity, deubiquitinating activity, adenylation activity, deadenylation activity, SUMOylating activity, deSUMOylating activity, ribosylation activity, deribosylation activity, myristoylation activity, demyristoylation activity, glycosylation activity (e.g., from O-GlcNAc transferase) and deglycosylation activity.
36 . The fusion polypeptide of claim 23 , wherein at least one of the one or more heterologous polypeptides is an endosomal escape polypeptide.
37 . The fusion polypeptide of claim 23 , wherein at least one of the one or more heterologous polypeptides is a protein that increases or decreases transcription.
38 . The fusion polypeptide of claim 37 , wherein at least one of the one or more heterologous polypeptides is a transcriptional repressor polypeptide.
39 . The fusion polypeptide of claim 37 , wherein at least one of the one or more heterologous polypeptides is a transcriptional activation polypeptide.
40 . The fusion polypeptide of claim 23 , wherein at least one of the one or more heterologous polypeptides is a protein binding polypeptide.
41 . A nucleic acid comprising a nucleotide sequence encoding the fusion polypeptide of claim 23 .
42 . A recombinant expression vector comprising the nucleic acid of claim 41 .
43 . A cell comprising one or more of:
a) a variant CRISPR-Cas effector polypeptide of claim 1 ;
b) a nucleic acid comprising a nucleotide sequence encoding a variant CRISPR-Cas effector polypeptide of claim 1 ;
c) a fusion polypeptide of claim 23 ;
d) a nucleic acid comprising a nucleotide sequence encoding a fusion polypeptide of claim 23 ;
e) a guide nucleic acid, wherein the guide nucleic acid comprises: i) an activator region that can bind to and activate the variant CRISPR-Cas effector polypeptide of claim 1 ; and ii) a guide sequence that can hybridize with a target region of a target nucleic acid; and
f) a nucleic acid encoding the guide nucleic acid.
44 . The cell of claim 43 , wherein the cell is a eukaryotic cell.
45 . The cell of claim 44 , wherein the eukaryotic cell is a plant cell, a mammalian cell, an insect cell, an arachnid cell, a fungal cell, a bird cell, a reptile cell, an amphibian cell, an invertebrate cell, a mouse cell, a rat cell, a primate cell, a non-human primate cell, or a human cell.
46 . The cell of claim 43 , wherein the cell is in vitro.
47 . The cell of claim 43 , wherein the cell is in vivo.
48 . A method of modifying a target nucleic acid, the method comprising contacting the target nucleic acid with: a) a variant CRISPR-Cas effector polypeptide of claim 1 ; and b) a guide nucleic acid, wherein the guide nucleic acid comprises: i) an activator region that can bind to and activate the variant CRISPR-Cas effector polypeptide; and ii) a guide sequence that can hybridize with a target region of a target nucleic acid.
49 . The method of claim 48 , wherein said modification is cleavage of the target nucleic acid.
50 . The method of claim 48 , wherein the target nucleic acid is selected from: double stranded DNA, single stranded DNA, RNA, genomic DNA, and extrachromosomal DNA.
51 . The method of claim 48 , wherein said contacting takes place in vitro outside of a cell.
52 . The method of claim 48 , wherein said contacting takes place inside of a cell in vitro.
53 . The method of claim 48 , wherein said contacting takes place inside of a cell in vivo.
54 . The method of claim 52 , wherein the cell is a eukaryotic cell.
55 . The method of claim 54 , wherein the cell is selected from: a plant cell, a fungal cell, a mammalian cell, a reptile cell, an insect cell, an avian cell, a fish cell, a parasite cell, an arthropod cell, a cell of an invertebrate, a cell of a vertebrate, a rodent cell, a mouse cell, a rat cell, a primate cell, a non-human primate cell, and a human cell.
56 . The method of claim 52 , wherein the cell is a prokaryotic cell.
57 . The method of claim 48 , wherein said contacting results in genome editing.
58 . The method of claim 52 , wherein said contacting comprises introducing into the cell:
a) the variant CRISPR-Cas effector polypeptide, or a nucleic acid comprising a nucleotide sequence encoding the variant CRISPR-Cas effector polypeptide; and
b) the guide RNA, or a nucleic acid comprising a nucleotide sequence encoding the guide RNA.
59 . The method of claim 58 , further comprising introducing a DNA donor nucleic acid into the cell.
60 . A method of modulating transcription from a target DNA, modifying a target nucleic acid, or modifying a protein associated with a target nucleic acid, the method comprising contacting the target nucleic acid with: a) a fusion polypeptide of claim 23 ; and b) a guide RNA comprising: i) an activator region that can bind to and activate the variant CRISPR-Cas effector polypeptide; and ii) a guide sequence that can hybridize with a target region of the target nucleic acid.
61 . The variant CRISPR-Cas effector polypeptide of claim 7 , wherein the variant CRISPR-Cas effector polypeptide comprises one or more mutations corresponding to D672A, E769A, and/or D935A of SEQ ID NO: 1.
62 . The method of claim 53 , wherein the cell is a eukaryotic cell.
63 . The method of claim 62 , wherein the cell is selected from: a plant cell, a fungal cell, a mammalian cell, a reptile cell, an insect cell, an avian cell, a fish cell, a parasite cell, an arthropod cell, a cell of an invertebrate, a cell of a vertebrate, a rodent cell, a mouse cell, a rat cell, a primate cell, a non-human primate cell, and a human cell.
64 . The method of claim 53 , wherein said contacting comprises introducing into the cell:
a) the variant CRISPR-Cas effector polypeptide, or a nucleic acid comprising a nucleotide sequence encoding the variant CRISPR-Cas effector polypeptide; and
b) the guide RNA, or a nucleic acid comprising a nucleotide sequence encoding the guide RNA.
65 . The method of claim 64 , further comprising introducing a DNA donor nucleic acid into the cell.