IP Library › Granted Patent US 12674151

Granted Patent B2

US 12674151 · App. 19/331,096 · Granted Jul 7, 2026

Compositions and methods for kallikrein (KLKB1) gene editing

Inventors: Shobu Odate (Arlington, MA); Jessica Lynn Seitzer (Windham, NH)

Assignee: Intellia Therapeutics, Inc.

C12N9/22 A61P43/00 C12N15/102 C12N2310/20 C12N2310/32

View Patent ↗

Loading inventors, assignments & file history…

Monitor This Case

Get email alerts when status or documents change.

Order Certified Copies

Most orders are placed with the USPTO same day — all within 24 business hours.

Order via The Patent Place →

Pre-filled with this patent's details

Quick Facts

Patent No.: US 12674151
App. No.: 19/331,096
Granted: Jul 7, 2026
Kind: B2

External Links

USPTO Patent Center↗ Full Patent PDF↗

Abstract

Compositions and methods for editing, e.g., introducing double-stranded breaks, within the KLKB1 gene are provided. Compositions and methods for treating subjects having hereditary angioedema (HAE), are provided.

Claims (56)

1 . A single guide RNA (sgRNA) comprising, in 5′ to 3′ order:

(i) a guide sequence that is 20 to 25 nucleotides in length and comprises the nucleotide sequence GGAUUGCGUAUGGGACACAA (SEQ ID NO: 15); and

(ii) a nucleotide sequence comprising GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC UUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:171).

2 . The sgRNA of claim 1 , wherein the sgRNA comprises at least one chemical modification of a sugar group or a phosphate group of a nucleotide within the sequence GGAUUGCGUAUGGGACACAA (SEQ ID NO:15) or the sequence GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUG AAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:171).

3 . The sgRNA of claim 2 , wherein the at least one chemical modification is (a) a replacement of the 2′ hydroxyl on the sugar group with 2′-O-methyl (a 2′-O-Me modification) and/or (b) the substitution of a nonbridging phosphate oxygen of the phosphate group with S-(a phosphorothioate (PS) bond).

4 . The sgRNA of claim 3 , wherein the sgRNA comprises a 2′-O-Me modification at one or more of the first three nucleotides at the 5′ terminus of SEQ ID NO: 15 and/or at one or more of the last three nucleotides at the 3′ end of SEQ ID NO: 171.

5 . The sgRNA of claim 3 , wherein the sgRNA comprises PS bonds between two or more of the first four nucleotides at the 5′ terminus of SEQ ID NO: 15 and/or between three or more of the last four nucleotides at the 3′ terminus of SEQ ID NO: 171.

6 . The sgRNA of claim 2 , wherein the sgRNA comprises GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCG UUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCm GmGmUmGmCmU*mU*mU*mU (SEQ ID NO:405), wherein a * denotes a PS bond and “mA,” “mC,” “mU,” and “mG” each denote a nucleotide containing a 2′-O-Me modification.

7 . The sgRNA of claim 6 , wherein the sgRNA comprises mG*mG*mA*UUGCGUAUGGGACACAAGUUUUAGAmGmCmUmAmGmAmAmAmUmAm GmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGm UmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 603), wherein a * denotes a PS bond and “mA,” “mC,” “mU,” and “mG” each denote a nucleotide containing a 2′-O-Me modification.

8 . The sgRNA of claim 7 , wherein the sgRNA consists of mG*mG*mA*UUGCGUAUGGGACACAAGUUUUAGAmGmCmUmAmGmAmAmAmUmA mGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAm GmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 603), wherein a * denotes a PS bond and “mA,” “mC,” “mU,” and “mG” each denote a nucleotide containing a 2′-O-Me modification.

9 . The sgRNA of claim 1 , wherein the guide sequence is 20 nucleotides in length.

10 . A composition comprising

(a) a single guide RNA (sgRNA) comprising, in 5′ to 3′ order:

(i) a guide sequence that is 20 to 25 nucleotides in length and comprises the nucleotide sequence GGAUUGCGUAUGGGACACAA (SEQ ID NO: 15); and

(ii) a nucleotide sequence comprising GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC UUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:171); and

(b) a lipid nanoparticle (LNP) comprising an ionizable lipid.

11 . The composition of claim 10 , wherein the ionizable lipid is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate.

12 . The composition of claim 10 , wherein the LNP further comprises a helper lipid, a neutral lipid, and a stealth lipid.

13 . The composition of claim 10 , wherein the LNP comprises:

(i) (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate;

(ii) disteroylphosphatidylcholine;

(iii) cholesterol; and

(iv) PEG2k-DMG.

14 . The composition of claim 10 , further comprising a Cas9 protein or a messenger RNA (mRNA) comprising a sequence encoding a Cas9 protein.

15 . The composition of claim 10 , wherein the sgRNA comprises mG*mG*mA*UUGCGUAUGGGACACAAGUUUUAGAmGmCmUmAmGmAmAmAmUmA mGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAm GmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 603), wherein a * denotes a PS bond and “mA,” “mC,” “mU,” and “mG” each denote a nucleotide containing a 2′-O-Me modification.

16 . The composition of claim 14 , wherein the sgRNA comprises mG*mG*mA*UUGCGUAUGGGACACAAGUUUUAGAmGmCmUmAmGmAmAmAmUmA mGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAm GmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 603), wherein a * denotes a PS bond and “mA,” “mC,” “mU,” and “mG” each denote a nucleotide containing a 2′-O-Me modification.

17 . The composition of claim 15 , wherein the sgRNA consists of mG*mG*mA*UUGCGUAUGGGACACAAGUUUUAGAmGmCmUmAmGmAmAmAmUmA mGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAm GmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 603).

18 . The composition of claim 16 , wherein the sgRNA consists of mG*mG*mA*UUGCGUAUGGGACACAAGUUUUAGAmGmCmUmAmGmAmAmAmUmA mGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAm GmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 603).

19 . The composition of claim 15 , wherein the ionizable lipid is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate.

20 . The composition of claim 15 , wherein the LNP further comprises a helper lipid, a neutral lipid, and a stealth lipid.

21 . The composition of claim 15 , wherein the LNP comprises:

(ii) disteroylphosphatidylcholine;

(iii) cholesterol; and

(iv) PEG2k-DMG.

22 . The composition of claim 16 , wherein the ionizable lipid is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate.

23 . The composition of claim 16 , wherein the LNP further comprises a helper lipid, a neutral lipid, and a stealth lipid.

24 . The composition of claim 16 , wherein the LNP comprises:

(ii) disteroylphosphatidylcholine;

(iii) cholesterol; and

(iv) PEG2k-DMG.

25 . The composition of claim 17 , wherein the wherein the ionizable lipid is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate.

26 . The composition of claim 17 , wherein the LNP further comprises a helper lipid, a neutral lipid, and a stealth lipid.

27 . The composition of claim 17 , wherein the LNP comprises:

(ii) disteroylphosphatidylcholine;

(iii) cholesterol; and

(iv) PEG2k-DMG.

28 . The composition of claim 18 , wherein the wherein the ionizable lipid is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate.

29 . The composition of claim 18 , wherein the LNP further comprises a helper lipid, a neutral lipid, and a stealth lipid.

30 . The composition of claim 18 , wherein the LNP comprises:

(ii) disteroylphosphatidylcholine;

(iii) cholesterol; and

(iv) PEG2k-DMG.