Amplification primer kit, a method for detecting a sexually transmitted bacterial infection, and a kit for detecting the infection

1 . A set of primers for amplifying the nucleotide sequence of the Neisseria gonorrhoeae dcm gene, characterized in that the set of primers contains a set of internal primers with the following nucleotide sequences a) and b), as well as a set of external primers containing the following sequences c) and d):

a) FIP primer comprising a 5′ segment comprising 5′ ATCTTTGGGGCTTGCGGGTG 3′ (SEQ ID NO: 3) and a 3′ segment comprising 5′ TAAAGCGTGGGATGAACAGG 3′ (SEQ ID NO: 4);

b) BIP primer comprising a 5′ segment comprising 5′ AAGCACGGGGCAAACGACTA 3′ (SEQ ID NO: 5) and a 3′ segment comprising 5′ CAACTTCGCGTACCGTCAT 3′ (SEQ ID NO: 6);

c) 5′ TATGAGCCGGAACCGAGT 3′ (SEQ ID NO: 1); and

d) 5′ TCGGGAAAGCCTTGGATTC 3′ (SEQ ID NO: 2).

2 . The set of primers of claim 1 , characterized in that it further contains a set of loop primer sequences comprising 5′ CCTGAAGCTTGGACGGTAAAAC 3′ (SEQ ID NO:7) and 5′ GCCGGCAAAGAAACACTATATCGG 3′ (SEQ ID NO: 8).

3 . A method of detecting Neisseria gonorrhoeae bacteria, characterized in that a selected region of the nucleic acid sequence of the bacterial genome is amplified using the set of primers as defined in claim 1 , the amplification method being the LAMP method.

4 . The method of detecting bacteria of claim 3 , characterized in that the amplification is carried out with a temperature profile of:

69° C., 40 min.

5 . The method of claim 4 , characterized in that an end-point reaction is carried out with an additional temperature profile stage of 80° C., 5 min.

6 . A kit for detecting infection with Neisseria gonorrhoeae bacterium, characterized in that it comprises a set of primers as defined in claim 1 in a tube.

7 . The infection detection kit of claim 6 , wherein the primers have the following concentrations:

primer c) at 0.12 μM,

primer d) at 0.12 μM,

primer b) at 0.96 μM, and

primer a) at 0.96 μM.

8 . The infection detection kit of claim 7 , further comprising D-(+)-Trehalose dihydrate.

9 . The infection detection kit of claim 7 , further comprising a fluorescent marker capable of interacting with double-stranded DNA.

10 . A method of detecting Neisseria gonorrhoeae bacteria, characterized in that a selected region of the nucleic acid sequence of the bacterial genome is amplified using the set of primers as defined in claim 2 , the amplification method being the LAMP method.

11 . The method of detecting bacteria of claim 10 , characterized in that the amplification is carried out with a temperature profile of:

69° C., 40 min.

12 . The method of claim 11 , characterized in that an end-point reaction is carried out with a temperature profile of 80° C., for additional 5 min.