One-step method for producing adenoviral vectors
The disclosure is directed to a gene transfer vector which comprises (i) all or part of a viral genome and (ii) a suicide gene flanked by unique cloning sequences. The disclosure also is directed to a system for producing an adenoviral vector comprising a destination vector comprising (i) all or part of an adenoviral genome and (ii) a suicide gene flanked by unique cloning sequences; a transgene flanked by unique cloning sequences; and (c) reagents for Gibson DNA Assembly (GDA). A method of producing an adenoviral vector using the aforementioned system also is provided.
1 . A gene transfer vector comprising (i) all or part of a viral genome, wherein the viral genome does not comprise an E1 region and (ii) a suicide gene flanked by a first cloning nucleic acid sequence and a second cloning nucleic acid sequence, wherein the first cloning nucleic acid sequence comprises SEQ ID NO: 1 (AATCGGAAAGCGGACGCGGA) and the second cloning nucleic acid sequence comprises SEQ ID NO: 2 (CGAGTATCCCGTGAGCGCTT).
2 . The gene transfer vector of claim 1 , wherein the viral genome is an adenovirus genome.
3 . The gene transfer vector of claim 2 , wherein the adenovirus is serotype 5.
4 . The gene transfer vector of claim 1 , wherein the suicide gene is a bacterial suicide gene.
5 . The gene transfer vector of claim 4 , wherein the bacterial suicide gene is a ccdB gene.
6 . A composition comprising the gene transfer vector of claim 1 and a pharmaceutically acceptable carrier.
7 . A system for producing an adenoviral vector, which comprises:
(a) a vector comprising (i) all or part of an adenoviral genome, wherein the viral genome does not comprise an E1 region and (ii) a suicide gene flanked by a first cloning nucleic acid sequence and a second cloning nucleic acid sequence, wherein the first cloning nucleic acid sequence comprises SEQ ID NO: 1 (AATCGGAAAGCGGACGCGGA) and the second cloning nucleic acid sequence comprises SEQ ID NO: 2 (CGAGTATCCCGTGAGCGCTT) wherein the first and second cloning nucleic acid sequences are different;
(b) a transgene flanked by the first cloning nucleic acid sequence and the second cloning nucleic acid sequence; and
(c) reagents for isothermal DNA assembly.
8 . The system of claim 7 , wherein the adenovirus is serotype 5.
9 . The system of claim 7 , wherein the suicide gene is a bacterial suicide gene.
10 . The system of claim 9 , wherein the bacterial suicide gene is a ccdB gene.
11 . A method of producing an adenoviral vector comprising contacting a cell with the system of claim 7 .