IP Library Granted Patent US 12680110
Granted Patent B2
US 12680110 · App. 17/819,539 · Granted Jul 14, 2026

One-step method for producing adenoviral vectors

Inventor: Tong-Chuan He (Chicago, IL)
Assignee: The University of Chicago
C12N15/86C07K14/245C12N2710/10043
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 12680110
App. No.
17/819,539
Granted
Jul 14, 2026
Kind
B2
Abstract

The disclosure is directed to a gene transfer vector which comprises (i) all or part of a viral genome and (ii) a suicide gene flanked by unique cloning sequences. The disclosure also is directed to a system for producing an adenoviral vector comprising a destination vector comprising (i) all or part of an adenoviral genome and (ii) a suicide gene flanked by unique cloning sequences; a transgene flanked by unique cloning sequences; and (c) reagents for Gibson DNA Assembly (GDA). A method of producing an adenoviral vector using the aforementioned system also is provided.

Claims (14)

1 . A gene transfer vector comprising (i) all or part of a viral genome, wherein the viral genome does not comprise an E1 region and (ii) a suicide gene flanked by a first cloning nucleic acid sequence and a second cloning nucleic acid sequence, wherein the first cloning nucleic acid sequence comprises SEQ ID NO: 1 (AATCGGAAAGCGGACGCGGA) and the second cloning nucleic acid sequence comprises SEQ ID NO: 2 (CGAGTATCCCGTGAGCGCTT).

2 . The gene transfer vector of claim 1 , wherein the viral genome is an adenovirus genome.

3 . The gene transfer vector of claim 2 , wherein the adenovirus is serotype 5.

4 . The gene transfer vector of claim 1 , wherein the suicide gene is a bacterial suicide gene.

5 . The gene transfer vector of claim 4 , wherein the bacterial suicide gene is a ccdB gene.

6 . A composition comprising the gene transfer vector of claim 1 and a pharmaceutically acceptable carrier.

7 . A system for producing an adenoviral vector, which comprises:

(a) a vector comprising (i) all or part of an adenoviral genome, wherein the viral genome does not comprise an E1 region and (ii) a suicide gene flanked by a first cloning nucleic acid sequence and a second cloning nucleic acid sequence, wherein the first cloning nucleic acid sequence comprises SEQ ID NO: 1 (AATCGGAAAGCGGACGCGGA) and the second cloning nucleic acid sequence comprises SEQ ID NO: 2 (CGAGTATCCCGTGAGCGCTT) wherein the first and second cloning nucleic acid sequences are different;

(b) a transgene flanked by the first cloning nucleic acid sequence and the second cloning nucleic acid sequence; and

(c) reagents for isothermal DNA assembly.

8 . The system of claim 7 , wherein the adenovirus is serotype 5.

9 . The system of claim 7 , wherein the suicide gene is a bacterial suicide gene.

10 . The system of claim 9 , wherein the bacterial suicide gene is a ccdB gene.

11 . A method of producing an adenoviral vector comprising contacting a cell with the system of claim 7 .