Pathogen detection in liquid matrix
Methods, reagents and a kit for the detection of a pathogen in a test sample, notably a sample of an environmental water matrix. The method involves the detection by multiplex digital PCR (dPCR) of several pathogen sequences without prior purification of the sample. Also, a method for detection of the Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) virus in a sample, notably sample of an environmental water matrix.
1 . A method of detecting a pathogen in an environmental liquid matrix, comprising:
a) taking a sample of the environmental liquid matrix,
b) extracting nucleic acid without prior purification of the sample, notably without prior clarification of the sample, and
c) amplifying at least 2 pathogen sequences in a multiplex digital PCR (dPCR) reaction using the nucleic acid of step b) as a template.
2 . The method of claim 1 , wherein the environmental liquid matrix is selected in the group consisting of: ground water, precipitation (rain or snow), surface water (lakes, ponds, river, runoff, etc.), ice or glacial melt, saline water, estuarian water and brines, waste water (domestic, landfill leachates, mine runoff, etc.), industrial process water and drinking water.
3 . The method of claim 1 , comprising a further step of concentrating the sample by contacting the sample with a centrifugal filter, wherein this further step takes place after step a).
4 . The method of claim 3 , comprising centrifuging the sample contacted with the centrifugal filter and recovering the supernatant, wherein the supernatant volume is less than 2 mL.
5 . The method of claim 3 , wherein the centrifugal filter is contacted with water prior to contacting the centrifugal filter with the sample, wherein the water is preferably at a temperature comprised between 60° C. and 80° C.
6 . The method of claim 3 , wherein molecules having a molecular weight below 10 kDa are separated from the sample by the further step.
7 . The method of claim 1 , wherein the sample is homogenised before the RNA extraction.
8 . The method of claim 1 , wherein the pathogen is
a bacteria selected from the group consisting of Salmonella spp., Y. pestis, Y. pseudotuberculosis, Y. enterocolitica, Listeria monocytogenes, Taylorella equigenitalis, Mycoplasma gallisepticum, Mycoplasma synoviae, Trichinella spp., Toxoplasma gondii, Escherichia coli, Streptococcus uberis, Staphylococcus aureus, L. pneumophila ; or
a virus selected from the group consisting of adenoviruses, astroviruses, hepatitis A and E viruses, rotavirus, norovirus, coxsackieviruses, polioviruses, polyomaviruses, cytomegalovirus, influenza viruses, coronaviruses, porcine epidemic diarrhoea virus, SARS-CoV-1, SARS-CoV-2, MERS Cov, Paramyxoviridae, bluetongue virus (BTV), bovine viral diarrhoea virus (BVDV), Schmallenberg virus, classical swine fever virus (CSFV), Betaarterivirus suid 1, and African Swine Fever Virus; or
a fungus selected from the group consisting of Candida albicans, Cryptococcus neoformans, Aspergillus fumigatus, Aspergillus niger, Trichophyton spp, Fusarium, Scedosporium, Alternaria, Exophiala, Histoplasma, Coccidioides , and Penicillium marneffei ; or
mixtures thereof.
9 . The method of claim 1 , wherein the virus is SARS-CoV-2.
10 . The method of claim 1 , wherein the multiplex dPCR reaction comprises using at least one probe selected in the group consisting of:
(SEQ ID NO. 1)
ACCCCGCATTACGTTTGGTGGACC,
(SEQ ID NO. 2)
ACAATTTGCCCCCAGCGCTTCAG,
and
(SEQ ID NO. 3)
ACACTAGCCATCCTTACTGCGCTTCG.
11 . The method of claim 1 , wherein the multiplex dPCR reaction comprises using at least one, at least two, at least three, at least four, at least five, or at least six primers selected in the group consisting of:
(SEQ ID NO. 4)
GACCCCAAAATCAGCGAAAT,
(SEQ ID NO. 5)
TCTGGTTACTGCCAGTTGAATCTG,
(SEQ ID NO. 6)
TTACAAACATTGGCCGCAAA,
(SEQ ID NO. 7)
GCGCGACATTCCGAAGAA,
(SEQ ID NO. 8)
ACAGGTACGTTAATAGTTAATAGCGT,
and
(SEQ ID NO. 9)
ATATTGCAGCAGTACGCACACA.
12 . The method of claim 1 , wherein the multiplex dPCR reaction comprises further using at least one probe of sequence: CCTACCGAAGCAAATG (SEQ ID NO. 10).
13 . The method of claim 1 , wherein the multiplex dPCR reaction comprises using a primer set comprising:
(SEQ ID NO. 11)
GAGTGGTTTGACCTTAACGTTTGA,
and
(SEQ ID NO. 12)
TTGTCGGTTGCAATGCAAGT.
14 . The method of claim 11 , comprising a further step of quantifying the amount of a SARs-CoV-2 nucleic acid comprising the sequence amplified with the primers in the sample of the environmental liquid matrix based on the amplification of step c).
15 . The method of claim 13 , comprising a further step of quantifying the amount of a nucleic acid comprising the sequence amplified with the primers in the sample of the environmental liquid matrix based on the amplification of step c).
16 . The method of claim 15 , comprising a further step of normalising an amount of a SARs-CoV-2 nucleic acid comprising the sequence amplified with at least one, at least two, at least three, at least four, at least five, or at least six primers selected in the group consisting of:
(SEQ ID NO. 4)
GACCCCAAAATCAGCGAAAT,
(SEQ ID NO. 5)
TCTGGTTACTGCCAGTTGAATCTG,
(SEQ ID NO. 6)
TTACAAACATTGGCCGCAAA,
(SEQ ID NO. 7)
GCGCGACATTCCGAAGAA,
(SEQ ID NO. 8)
ACAGGTACGTTAATAGTTAATAGCGT,
and
(SEQ ID NO. 9)
ATATTGCAGCAGTACGCACACA
to the amount of nucleic acid comprising the sequence amplified with the primer set comprising:
(SEQ ID NO. 11)
GAGTGGTTTGACCTTAACGTTTGA,
and
(SEQ ID NO. 12)
TTGTCGGTTGCAATGCAAGT.
17 . A method for detecting a SARS-CoV-2 infection in a population comprising detecting SARS-CoV-2 in wastewater according to the method of claim 1 .
18 . The method of claim 8 , wherein the pathogen is an influenza A virus of human, avian, or swine origin.
19 . The method of claim 8 , wherein the pathogen is a Paramyxoviridae with Morbillivirus genus.