Thin, flexible wearable immunosensor for detection of multiple biomarkers/targets in bodily fluids
A layered dressing includes: a permeable wound contact layer for placing in contact with a wound; a breathable barrier layer; a biosensor sensing array configured to detect one or more markers in wound fluid; and a fluid collection layer disposed between the wound contact layer and breathable barrier layer and configured to deliver wound fluid by capillary action from a wound in contact with the wound contact layer to the biosensor sensing array.
1 . A layered dressing comprising:
a permeable wound contact layer for placing in contact with a wound;
a breathable barrier layer;
a fluid collection layer disposed between the wound contact layer and breathable barrier layer, the fluid collection layer comprising a biosensor housing portion and a fluid collection portion comprising a plurality of channels each having a terminus at the biosensor housing portion; and
a biosensor sensing array comprising one or more electrodes, the biosensor sensing array being disposed between the biosensor housing portion of the fluid collection layer and the breathable barrier layer,
wherein:
the channels within the fluid collection portion of the fluid collection layer are configured to allow the flow of fluid from a wound in only a single direction along the channels, where the channels each comprise a plurality of interconnected half-open saw-tooth-shaped capillary channels; and
the channels comprise a first portion configured to draw fluid from a wound in contact with the wound contact layer, and a second portion proximal to the biosensor sensing array as compared to the first portion, where the width of the channels at the first portion is greater than the width of the channels at the second portion such that, when in use, the channels deliver wound fluid by capillary action from a wound in contact with the wound contact layer to the biosensor sensing array, and where the biosensor sensing array is configured to detect one or more markers in said wound fluid.
2 . The layered dressing according to claim 1 , wherein the wound contact layer comprises a plurality of perforations.
3 . The layered dressing according to claim 1 , wherein the fluid collection portion of the fluid collection layer has an annular shape having an outer surface, where annular shape defines a central portion, and where the biosensor housing portion of the fluid collection layer is located at the central portion.
4 . The layered dressing according to claim 1 , wherein the biosensor sensing array comprises one or more electrodes, each electrode being configured to detect a marker selected from the group consisting of a healing biomarker and a bioburden biomarker.
5 . The layered dressing according to claim 4 , wherein the healing biomarker is selected from the group consisting of TNF-α, IL-6, IL-8, TGF-β 1 , and pH.
6 . The layered dressing according to claim 1 , wherein the biosensor sensing array comprises two or more electrodes, each electrode being configured to detect a marker selected from the group consisting of TNF-α, IL-6, IL-8, TGF-β 1 , pH and a biomarker for S. aureus.
7 . The layered dressing according to claim 6 , wherein the biosensor sensing array comprises six electrodes, each electrode being configured to detect a marker selected from the group consisting of TNF-α, IL-6, IL-8, TGF-β 1 , pH and a biomarker for S. aureus , such that the biosensor sensing array is able to simultaneously detect TNF-α, IL-6, IL-8, TGF-β 1 , pH and a biomarker for S. aureus.
8 . The layered dressing according to claim 1 , wherein the biosensor sensing array comprises one or more aptamer-based working electrodes, each comprising an aptamer bonded to an electrode, where the aptamer is suitable for detecting a marker in the wound fluid.
9 . The layered dressing according to claim 8 , wherein the one or more aptamer-based working electrodes comprises an aptamer for IL-8, IL-6, TNF-α, TGF-β 1 and/or S. aureus.
10 . The layered dressing according to claim 9 , wherein any one of the following applies:
(a) the aptamer for IL-8 comprises the sequence 5′-/5ThioMC6-D/rGrGrGrGrGrCrUrUrArUrCrArUrUrCrCrArUrUrUrArGrUrGrUrUrArUrGrArUrArA rCrC/3MeBIN/-3′;
(b) the aptamer for IL-6 comprises the sequence 5′-/5ThioMC6-D/GGTGGCAGGAGGACTATTTATTTGCTTTTCT/3MeBIN/-3′;
(c) the aptamer for TNF-α comprises the sequence 5′-/5MeBIN/rG*rG*rA*rG*rU*rA*rU*rC*rU*rG*rA*rU*rG*rA*rC*rA*rA*rU*rU*rC*r G*rG*rA*rG*rC*rU*rC*rC/3ThioMC3-D/-3′;
(d) the aptamer for TGF-1 comprises the sequence 5′-/5MeBIN/CG*CTCGG*CTTC*ACG*AG*ATT*CGTGT*CGTTGTGT*C*CTGT*A*C*C*CG*C*CTTG*A*C*C*AGT*C*ACT*CT*AG*AGC*AT*C*CGG*A*CTG/iSpC3/3ThioMC3-D/-3′; and
for S. aureus comprises the sequence 5′-/5ThioMC6-(e) the aptamer D/TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC/3MeBl N/-3′.
11 . The layered dressing according to claim 10 , wherein:
(a) the aptamer for IL-8 comprises the sequence 5′-/5ThioMC6-D/rGrGrGrGrGrCrUrUrArUrCrArUrUrCrCrArUrUrUrArGrUrGrUrUrArUrGrArUrArA rCrC/3MeBIN/-3′; or
(b) the aptamer for IL-6 comprises the sequence 5′-/5ThioMC6-D/GGTGGCAGGAGGACTATTTATTTGCTTTTCT/3MeBIN/-3′.
12 . The layered dressing according to claim 8 , wherein the aptamer comprises a first end region and a second end region, and where the aptamer is bonded to the electrode via the first end region.
13 . The layered dressing according to claim 12 , wherein the surface of the one or more aptamer-based working electrodes comprises a layer of electrochemically exfoliated graphene-gold nanoparticles (AuNPs-GP) nanocomposite.
14 . The layered dressing according to claim 8 , wherein the aptamer is conjugated to a redox label, optionally wherein the redox label is methylene blue.
15 . The layered dressing according to claim 1 , wherein the biosensor sensing array comprises one or more of the following:
(a) a polyaniline pH sensor; and
(b) a temperature sensor.
16 . The layered dressing according to claim 1 , wherein the biosensor sensing array is capable of wirelessly transmitting measurement data to a paired device.