Modified mRNA vaccines encoding herpes simplex virus glycoproteins and uses thereof

1 . A composition comprising a plurality of RNAs encoding HSV antigens, wherein the plurality of RNAs consist of:

(a) RNA encoding an immunogenic fragment of a Herpes Simplex Virus (HSV) glycoprotein D (gD), wherein the immunogenic fragment consists of a sequence that is at least 95% identical to SEQ ID NO: 5;

(b) RNA encoding an immunogenic fragment of an HSV glycoprotein C (gC), wherein the immunogenic fragment consists of a sequence that is at least 95% identical to SEQ ID NO: 11; and

(c) RNA encoding an immunogenic fragment of an HSV glycoprotein E (gE), wherein the immunogenic fragment consists of a sequence that is at least 95% identical to SEQ ID NO: 17;

wherein one or more of said RNAs is a nucleoside modified RNA.

2 . The composition of claim 1 , wherein said nucleoside modified RNA comprises one or more pseudouridine residues.

3 . The composition of claim 2 , wherein said one or more pseudouridine residues comprise m1Ψ (1-methylpseudouridine), m1acp3Ψ (1-methyl-3-(3-amino-5-carboxypropyl)pseudouridine, Ψm (2′-O-methylpseudouridine, m5D (5-methyldihydrouridine), m3Ψ (3-methylpseudouridine), or any combination thereof.

4 . The composition of claim 1 , wherein said RNA further comprises:

(i) a poly-A tail;

(ii) an m7GpppG cap, 3′-O-methyl-m7GpppG cap, or anti-reverse cap analog;

(iii) a cap-independent translational enhancer;

(iv) 5′ and 3′ untranslated regions that enhance translation; or

(v) a combination thereof.

5 . A method of treating a Herpes Simplex Virus (HSV) infection or suppressing, inhibiting, or reducing the incidence of an HSV infection in a subject, the method comprising the step of administering a composition to said subject, wherein the composition comprises a plurality of RNAs encoding HSV antigens, wherein the plurality of RNAs consist of:

(a) RNA encoding an immunogenic fragment of a Herpes Simplex Virus (HSV) glycoprotein D (gD), wherein the immunogenic fragment consists of a sequence that is at least 95% identical to SEQ ID NO: 5;

(b) RNA encoding an immunogenic fragment of an HSV glycoprotein C (gC), wherein the immunogenic fragment consists of a sequence that is at least 95% identical to SEQ ID NO: 11; and

(c) RNA encoding an immunogenic fragment of an HSV glycoprotein E (gE), wherein the immunogenic fragment consists of a sequence that is at least 95% identical to SEQ ID NO: 17;

wherein one or more of said RNAs is a nucleoside modified RNA.

6 . The method of claim 5 , wherein said HSV infection comprises an HSV-1 infection or an HSV-2 infection.

7 . The method of claim 5 , wherein said HSV infection comprises a primary HSV infection; a flare, recurrence, or HSV labialis following a primary HSV infection; a reactivation of a latent HSV infection; an HSV encephalitis; an HSV neonatal infection; a genital HSV infection; an oral HSV infection; or a combination thereof.

8 . The method of claim 5 , wherein the administration step comprises intramuscular, subcutaneous, intradermal, intranasal, intravaginal, intrarectal, or topical administration.

9 . A method of inducing an immune response in a subject, comprising the step of administering a composition to said subject, wherein the composition comprises a plurality of RNAs encoding HSV antigens, wherein the plurality of RNAs consist of:

(a) RNA encoding an immunogenic fragment of a Herpes Simplex Virus (HSV) glycoprotein D (gD);

(b) RNA encoding an immunogenic fragment of an HSV glycoprotein C (gC); and

(c) RNA encoding an immunogenic fragment of an HSV glycoprotein E (gE);

wherein one or more of said RNAs is a nucleoside modified RNA.

10 . The method of claim 9 , wherein said immune response comprises a CD4 immune response; a CD8 immune response; a T follicular helper cell immune response; a germinal center B cell immune response; an IgG antibody response; or a combination thereof.

11 . The composition of claim 1 , comprising:

(a) RNA encoding an immunogenic fragment of an gD and a signal sequence;

(b) RNA encoding an immunogenic fragment of an HSV gC and a signal sequence; and

(c) RNA encoding an immunogenic fragment of an HSV gE and a signal sequence.

12 . The composition of claim 11 , wherein the signal sequence of (b) is not a naturally occurring HSV gC signal sequence and/or the signal sequence of (c) is not a naturally occurring HSV gE signal sequence.

13 . The composition of claim 11 , wherein the signal sequence of (b) and/or the signal sequence of (c) comprises the nucleotide sequence of

(SEQ ID NO: 20)

AUGCGCAUGCAGCUGCUGCUGCUGAUCGCCCUGUCCCUGGCCCUGGUGA

CCAACUCC.

14 . The composition of claim 1 , wherein the composition does not include RNA encoding immunogenic fragments of any HSV antigen that is not HSV gD, HSV gC, or HSV gE.

15 . The composition of claim 1 , wherein the composition does not include RNA encoding an immunogenic fragment of an HSV glycoprotein B (gB), an HSV glycoprotein H (gH), an HSV glycoprotein L (gL), or an HSV glycoprotein I (gI).

16 . The composition of claim 1 , wherein the composition further comprises a nanoparticle, lipid, polymer, cholesterol, and/or cell penetrating peptide.

17 . The composition of claim 16 , wherein the nanoparticle is a lipid nanoparticle (LNP).