IP Library Granted Patent US 12702707
Granted Patent B2
US 12702707 · App. 18/470,325 · Granted Aug 11, 2026

Modified mRNA vaccines encoding herpes simplex virus glycoproteins and uses thereof

Inventors: Harvey Friedman (Merion, PA); Drew Weissman (Wynnewood, PA); Sita Awasthi (Bala Cynwyd, PA); Gary Cohen (Havertown, PA)
Assignee: The Trustees of the University of Pennsylvania
A61K39/245A61K9/0036A61P31/22C07K14/005C12N7/00C12N15/11A61K2039/53A61K2039/54A61K2039/57C12N2710/16622
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 12702707
App. No.
18/470,325
Granted
Aug 11, 2026
Kind
B2
Abstract

The present invention provides compositions for the prevention and treatment of genital herpes, comprising nucleoside modified mRNAs that encode herpes simplex virus (HSV) glycoproteins, including those involved in virus entry and immune evasion, and methods of use thereof.

Claims (40)

1 . A composition comprising a plurality of RNAs encoding HSV antigens, wherein the plurality of RNAs consist of:

(a) RNA encoding an immunogenic fragment of a Herpes Simplex Virus (HSV) glycoprotein D (gD), wherein the immunogenic fragment consists of a sequence that is at least 95% identical to SEQ ID NO: 5;

(b) RNA encoding an immunogenic fragment of an HSV glycoprotein C (gC), wherein the immunogenic fragment consists of a sequence that is at least 95% identical to SEQ ID NO: 11; and

(c) RNA encoding an immunogenic fragment of an HSV glycoprotein E (gE), wherein the immunogenic fragment consists of a sequence that is at least 95% identical to SEQ ID NO: 17;

wherein one or more of said RNAs is a nucleoside modified RNA.

2 . The composition of claim 1 , wherein said nucleoside modified RNA comprises one or more pseudouridine residues.

3 . The composition of claim 2 , wherein said one or more pseudouridine residues comprise m1Ψ (1-methylpseudouridine), m1acp3Ψ (1-methyl-3-(3-amino-5-carboxypropyl)pseudouridine, Ψm (2′-O-methylpseudouridine, m5D (5-methyldihydrouridine), m3Ψ (3-methylpseudouridine), or any combination thereof.

4 . The composition of claim 1 , wherein said RNA further comprises:

(i) a poly-A tail;

(ii) an m7GpppG cap, 3′-O-methyl-m7GpppG cap, or anti-reverse cap analog;

(iii) a cap-independent translational enhancer;

(iv) 5′ and 3′ untranslated regions that enhance translation; or

(v) a combination thereof.

5 . A method of treating a Herpes Simplex Virus (HSV) infection or suppressing, inhibiting, or reducing the incidence of an HSV infection in a subject, the method comprising the step of administering a composition to said subject, wherein the composition comprises a plurality of RNAs encoding HSV antigens, wherein the plurality of RNAs consist of:

(a) RNA encoding an immunogenic fragment of a Herpes Simplex Virus (HSV) glycoprotein D (gD), wherein the immunogenic fragment consists of a sequence that is at least 95% identical to SEQ ID NO: 5;

(b) RNA encoding an immunogenic fragment of an HSV glycoprotein C (gC), wherein the immunogenic fragment consists of a sequence that is at least 95% identical to SEQ ID NO: 11; and

(c) RNA encoding an immunogenic fragment of an HSV glycoprotein E (gE), wherein the immunogenic fragment consists of a sequence that is at least 95% identical to SEQ ID NO: 17;

wherein one or more of said RNAs is a nucleoside modified RNA.

6 . The method of claim 5 , wherein said HSV infection comprises an HSV-1 infection or an HSV-2 infection.

7 . The method of claim 5 , wherein said HSV infection comprises a primary HSV infection; a flare, recurrence, or HSV labialis following a primary HSV infection; a reactivation of a latent HSV infection; an HSV encephalitis; an HSV neonatal infection; a genital HSV infection; an oral HSV infection; or a combination thereof.

8 . The method of claim 5 , wherein the administration step comprises intramuscular, subcutaneous, intradermal, intranasal, intravaginal, intrarectal, or topical administration.

9 . A method of inducing an immune response in a subject, comprising the step of administering a composition to said subject, wherein the composition comprises a plurality of RNAs encoding HSV antigens, wherein the plurality of RNAs consist of:

(a) RNA encoding an immunogenic fragment of a Herpes Simplex Virus (HSV) glycoprotein D (gD);

(b) RNA encoding an immunogenic fragment of an HSV glycoprotein C (gC); and

(c) RNA encoding an immunogenic fragment of an HSV glycoprotein E (gE);

wherein one or more of said RNAs is a nucleoside modified RNA.

10 . The method of claim 9 , wherein said immune response comprises a CD4 immune response; a CD8 immune response; a T follicular helper cell immune response; a germinal center B cell immune response; an IgG antibody response; or a combination thereof.

11 . The composition of claim 1 , comprising:

(a) RNA encoding an immunogenic fragment of an gD and a signal sequence;

(b) RNA encoding an immunogenic fragment of an HSV gC and a signal sequence; and

(c) RNA encoding an immunogenic fragment of an HSV gE and a signal sequence.

12 . The composition of claim 11 , wherein the signal sequence of (b) is not a naturally occurring HSV gC signal sequence and/or the signal sequence of (c) is not a naturally occurring HSV gE signal sequence.

13 . The composition of claim 11 , wherein the signal sequence of (b) and/or the signal sequence of (c) comprises the nucleotide sequence of

(SEQ ID NO: 20)

AUGCGCAUGCAGCUGCUGCUGCUGAUCGCCCUGUCCCUGGCCCUGGUGA

CCAACUCC.

14 . The composition of claim 1 , wherein the composition does not include RNA encoding immunogenic fragments of any HSV antigen that is not HSV gD, HSV gC, or HSV gE.

15 . The composition of claim 1 , wherein the composition does not include RNA encoding an immunogenic fragment of an HSV glycoprotein B (gB), an HSV glycoprotein H (gH), an HSV glycoprotein L (gL), or an HSV glycoprotein I (gI).

16 . The composition of claim 1 , wherein the composition further comprises a nanoparticle, lipid, polymer, cholesterol, and/or cell penetrating peptide.

17 . The composition of claim 16 , wherein the nanoparticle is a lipid nanoparticle (LNP).