Method of assessing activity of recombinant antigen receptors
Provided herein are methods for screening for one or more activity of a recombinant receptor, including recombinant receptors containing an extracellular antigen-binding domain and an intracellular signaling domain, such as a chimeric antigen receptor (CAR). The methods include assessing activity of a cell expressing the recombinant receptor based on a detectable expression of a reporter molecule that is responsive to a signal through the intracellular signaling region of the recombinant receptor. In some embodiments, the activity assessed is an antigen-dependent or an antigen-independent activity. In some embodiments, the methods can be used to screen a plurality of reporter cells each containing a nucleic acid molecule encoding a candidate recombinant receptor, e.g. CAR, and assessing such cells or plurality of cells for one or more property or activity. The methods can be high-throughput. Also provided are reporter cells, cell compositions, nucleic acids and kits for use in the methods.
1 . A method for assessing activity of a recombinant receptor, comprising:
a) incubating one or more of reporter T cells, each of said reporter T cells comprising:
(i) a nucleic acid sequence encoding a reporter molecule integrated in an endogenous Nur77 locus under the operable control of a transcriptional regulatory element of the endogenous locus encoding Nur77 and
(ii) a recombinant receptor that is a chimeric antigen receptor (CAR) comprising an intracellular signaling region and a binding domain,
wherein the T cell is a Jurkat cell line or a derivative thereof, and
wherein the incubating is carried out in the presence or absence of an agent that binds to the binding domain of the recombinant receptor and/or an agent that induces or is capable of inducing a signal through the intracellular signaling region of the recombinant receptor; and
b) assessing the one or more reporter T cells for expression of the reporter molecule.
2 . The method of claim 1 , wherein the one or more reporter T cells comprise a plurality of reporter T cells each comprising a polynucleotide encoding a distinct recombinant receptor, wherein
the encoded distinct recombinant receptor in a reporter T cell in the plurality of reporter T cells is distinct from the encoded recombinant receptor present in at least one of the other reporter T cells in the plurality.
3 . The method of claim 1 , wherein the one or more reporter T cells are incubated in the presence of the agent that binds to the binding domain of the recombinant receptor and/or the agent that induces or is capable of inducing a signal through an intracellular signaling region of the recombinant receptor, thereby assessing antigen-specific activity of the recombinant receptor.
4 . The method of claim 1 , wherein the one or more reporter T cells are incubated in the absence of the agent that binds to the binding domain of the recombinant receptor and/or the agent that induces or is capable of inducing a signal through an intracellular signaling region of the recombinant receptor, thereby assessing tonic signaling and/or antigen independent activity of the recombinant receptor.
5 . The method of claim 2 , further comprising identifying one or more reporter T cells among the plurality that express the distinct recombinant receptor on the surface of the cell.
6 . The method of claim 1 , wherein the reporter molecule is or comprises a fluorescent protein, a luciferase, a β-galactosidase, a chloramphenicol acetyltransferase (CAT), or a β-glucuronidase (GUS).
7 . The method of claim 1 , wherein the agent comprises a target antigen or epitope specifically recognized by the recombinant receptor.
8 . The method of claim 2 , wherein the plurality of reporter T cells each comprise a polynucleotide encoding the CAR, wherein each polynucleotide is encoded from a vector backbone, wherein the vector backbone comprises a) regulatory elements for expression of components of the CAR, b) a nucleic acid sequence encoding a leader sequence comprising a molecular barcode, c) one or more site(s) for introduction of a nucleic acid sequence encoding the binding domain, d) a nucleic acid sequence encoding a spacer, and e) a nucleic acid sequence encoding the intracellular signaling region.
9 . The method of claim 1 , wherein prior to the incubating, the nucleic acid sequence encoding the reporter molecule is integrated by:
a) inducing a genetic disruption at one or more target site(s) at the endogenous locus encoding Nur77; and
b) introducing a template polynucleotide comprising the nucleic acid encoding the reporter molecule for homology directed repair (HDR).
10 . The method of claim 9 , wherein the genetic disruption is induced by a fusion protein comprising a DNA-targeting protein and a nuclease or a RNA-guided nuclease that is or comprises a zinc finger nuclease (ZFN), a TAL-effector nuclease, or a CRISPR-Cas9 combination that specifically binds to, recognizes, or hybridizes to the target site.
11 . The method of claim 1 , wherein the nucleic acid encoding the reporter is present within the genome at a site that is at or near the final exon of the endogenous locus encoding Nur77.
12 . The method of claim 9 , wherein the one or more target site(s) comprise the nucleic acid sequence TCATTGACAAGATCTTCATG (SEQ ID NO:65) and/or GCCTGGGAACACGTGTGCA (SEQ ID NO:66).
13 . The method of claim 9 , wherein the template polynucleotide comprises the structure [5′ homology arm]-[nucleic acid sequence encoding the reporter molecule]-[3′ homology arm], wherein the 5′ homology arm or 3′ homology arm comprises nucleic acid sequences homologous to nucleic acid sequences present at and/or surrounding the one or more target site(s).
14 . The method of claim 1 , wherein the one or more reporter T cells comprise a plurality of reporter T cells, and the method, further comprises identifying a T cell from the one or more reporter T cells among the plurality that express the reporter molecule in the presence of the agent, and/or that do not express the reporter molecule in the absence of the agent.
15 . The method of claim 1 , wherein the one or more reporter T cells comprise a plurality of reporter T cells, and the method further comprises identifying a T cell from the one or more reporter T cells among the plurality that express the reporter molecule in the presence of the agent, and that do not express the reporter molecule in the absence of the agent or have low antigen-independent activity or low tonic signaling.
16 . The method of claim 15 , wherein the agent comprises a target antigen or epitope specifically recognized by the recombinant receptor.
17 . The method of claim 16 , wherein the target antigen is expressed by target cells.
18 . The method of claim 1 , wherein the one or more reporter T cells are incubated with cells lacking expression of a target antigen of the recombinant receptor, such that the agent that binds to the binding domain of the recombinant receptor is absent, thereby assessing antigen-independent activity of the recombinant receptor.
19 . The method of claim 1 , wherein the one or more reporter T cells are incubated with target cells that express a target antigen recognized by the recombinant receptor, wherein the target antigen is the agent that binds to the binding domain of the recombinant receptor, thereby assessing antigen-dependent activity of the recombinant receptor.
20 . The method of claim 1 , wherein the one or more reporter T cells are separately incubated with (i) target cells that express a target antigen recognized by the recombinant receptor, wherein the antigen is the agent that binds to the binding domain of the recombinant receptor, and (ii) non-target cells that do not express the target antigen, wherein the method further comprises comparing the expression of the reporter molecule in the reporter T cells incubated with the target cells to the expression of the reporter molecule in the reporter T cells incubated with the non-target cells to determine antigen-dependent signaling and antigen-independent signaling via the recombinant receptor.
21 . The method of claim 20 , wherein the target cells and the non-target cells are of the same cell type, and the target cells are engineered to express the target antigen and the non-target cells do not express the target antigen.
22 . The method of claim 21 , further comprising identifying T cells that have greater signaling when the T cells are incubated with the target cells than signaling when the T cells are incubated with the non-target cells.
23 . The method of claim 20 , wherein the reporter molecule is or comprises a fluorescent protein, a luciferase, a β-galactosidase, a chloramphenicol acetyltransferase (CAT), or a β-glucuronidase (GUS).
24 . The method of claim 20 , wherein the agent comprises a target antigen or epitope specifically recognized by the recombinant receptor.
25 . The method of claim 20 , wherein the one or more target site(s) comprise, and/or the nucleic acid is present within the genome at a site comprising, the nucleic acid sequence TCATTGACAAGATCTTCATG (SEQ ID NO:65) and/or GCCTGGGAACACGTGTGCA (SEQ ID NO:66).
26 . The method of claim 20 , wherein the nucleic acid encoding the reporter molecule is present within the genome at a site that is at or near the final exon of the endogenous locus encoding Nur77.
27 . The method of claim 20 , wherein the agent comprises a target antigen or epitope specifically recognized by the recombinant receptor.
28 . The method of claim 20 , the Jurkat cell line or a derivative thereof is Jurkat T cell clone E6-1.