IP Library › Granted Patent US 12703863
Granted Patent B2
US 12703863 · App. 17/301,835 · Granted Aug 11, 2026

RNA G-quadruplex structure in pre-miRNA-1229 as a therapeutic target for Alzheimer's disease and various cancers

Inventors: Mihaela Rita Mihailescu (Pittsburgh, PA); Joshua A. Imperatore (Canonsburg, PA)
Assignee: DUQUESNE UNIVERSITY OF THE HOLY SPIRIT
C12N15/113C12N2310/3181C12N2310/322C12N2320/34
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 12703863
App. No.
17/301,835
Granted
Aug 11, 2026
Kind
B2
Abstract

Provided is an agent that binds to a wild type or variant pre-miRNA-1229 comprising a G-quadruplex (GQ) structure, wherein binding of the agent to the wild type or variant pre-miRNA-1229 stabilizes the GQ structure of the wild type or variant pre-miRNA-1229. In some embodiments, the variant is rs2291418. Provided is a method of treating a disease in a subject, comprising: administering a therapeutically effective amount of the agent to the subject. In some embodiments, the disease is Alzheimer's disease, cancer or coronary artery calcification.

Claims (2)

1 . An agent that binds to a wild type or variant pre-miRNA-1229 comprising a G-quadruplex (GQ) structure, wherein binding of the agent to the wild type or variant pre-miRNA-1229 stabilizes the GQ structure of the wild type or variant pre-miRNA-1229,wherein the agent consists of an oligonucleotide sequence comprising 2′-deoxy 2′-fluoroarabino oligonucleotides consisting of: GGGUGUCCCUGAACCCCAGC (SEQ ID NO:10), wherein the variant is rs2291418.

2 . A composition comprising the agent of claim 1 .