Methods of sequencing antibody chains from hybridomas and kits for practicing same
Aspects of the present disclosure include methods of sequencing antibody chains from hybridomas. In some embodiments, the methods comprise contacting hybridoma RNA with a constant region-specific reverse transcription primer, and contacting the hybridoma RNA with a reverse transcriptase with terminal nucleotidyl transferase activity, thereby creating a heavy chain and/or light chain cDNA. Such methods further comprise contacting the cDNA with a template switch oligonucleotide comprising a universal PCR primer sequence, thereby generating a single stranded cDNA, and performing second strand synthesis on the single stranded cDNA, thereby producing a double stranded heavy chain and/or light chain cDNA. A heavy chain and/or light chain sequencing template is produced, and the methods further comprise sequencing the template by Sanger sequencing. Also provided are kits that find use, e.g., in practicing the methods of the present disclosure.
1 . A method of sequencing the variable regions of a human monoclonal antibody produced by a hybridoma cell line, wherein the human monoclonal antibody comprises a heavy chain and a kappa light chain, the method comprising:
(a) annealing in a first reaction tube a heavy chain constant region-specific reverse transcription primer to the constant region of heavy chain transcripts extracted from cells of the hybridoma cell line, wherein the heavy chain transcripts encode the heavy chain constant and variable regions of the human monoclonal antibody;
(b) extending the heavy chain constant region-specific reverse transcription primer using a reverse transcriptase to synthesize a heavy chain complementary DNA (cDNA), wherein the heavy chain cDNA comprises a 3′ overhang produced by the reverse transcriptase;
(c) annealing a template switch oligonucleotide comprising a primer sequence to the 3′ overhang and extending the 3′ end of the heavy chain cDNA using the template switch oligonucleotide as template;
(d) performing second strand synthesis on the heavy chain cDNA using a primer comprising the primer sequence of the template switch oligonucleotide annealed at step (c) to produce a double-stranded heavy chain cDNA;
(e) PCR amplifying the double-stranded heavy chain cDNA using a primer comprising the primer sequence of the template switch oligonucleotide annealed at step (c) and a human heavy chain constant region-specific primer that anneals to a sequence nested within the cDNA sequence synthesized during step (b) to produce heavy chain cDNA amplicons, wherein
the human heavy chain constant region-specific primer that anneals to a sequence nested within the cDNA sequence synthesized during step (b) consists of the nucleotide sequence agggcgcctgagttccacg (SEQ ID NO: 12);
(f) annealing in a second reaction tube a human light chain constant region-specific reverse transcription primer to the constant region of human light chain transcripts extracted from cells of the hybridoma cell line, wherein the light chain transcripts encode the human light chain constant and variable regions of the human monoclonal antibody;
(g) extending the human light chain constant region-specific reverse transcription primer using a reverse transcriptase to synthesize a light chain cDNA, wherein the light chain cDNA comprises a 3′ overhang produced by the reverse transcriptase;
(h) annealing a template switch oligonucleotide comprising a primer sequence to the 3′ overhang and extending the 3′ end of the light chain cDNA using the template switch oligonucleotide as template;
(i) performing second strand synthesis on the light chain cDNA using a primer comprising the primer sequence of the template switch oligonucleotide annealed at step (h) to produce a double-stranded light chain cDNA;
(j) PCR amplifying the double-stranded light chain cDNA using a primer comprising the primer sequence of the template switch oligonucleotide annealed at step (h) and a human light chain constant region-specific primer that anneals to a sequence nested within the cDNA sequence synthesized during step (g) to produce light chain cDNA amplicons, wherein
the human light chain constant region-specific primer that anneals to a sequence nested within the cDNA sequence synthesized during step (g) consists of the nucleotide sequence tttggcctctctgggatagaag (SEQ ID NO: 11); and
(k) performing Sanger sequencing on the heavy chain cDNA amplicons and the kappa chain cDNA amplicons, thereby sequencing the variable regions of the human monoclonal antibody produced by the hybridoma cell line.
2 . The method according to claim 1 , wherein the heavy chain constant region-specific reverse transcription primer comprises the nucleotide sequence gccgggaaggtgtgcacg (SEQ ID NO: 10) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 10, and the kappa chain constant region-specific reverse transcription primer comprises the nucleotide sequence gattggagggcgttatccacc (SEQ ID NO: 9) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 9.
3 . The method according to claim 1 , wherein the reverse transcriptase is an MMLV reverse transcriptase.
4 . The method according to claim 1 , wherein the heavy chain cDNA amplicons and the kappa chain cDNA amplicons are cloned into a vector prior to step (k).