Oligonucleotides for nucleic acid amplification and for the detection of
View Patent ↗A method, composition and kit for synthesizing multiple copies of a target nucleic acid sequence autocatalytically under conditions of substantially constant temperature, ionic strength, and pH are provided in which multiple RNA copies of the target sequence autocatalytically generate additional copies using a mixture of blocked and unblocked primers and/or promoter-primers to initiate DNA and RNA synthesis, preferably with reduced non-specific product formation. The invention is useful for generating copies of a nucleic acid target sequence for purposes that include assays to quantitate specific nucleic acid sequences in clinical, environmental, forensic and similar samples, cloning and generating probes.
1. A kit for use in amplifying Mycobacterium tuberculosis nucleic acid, said kit containing:
a first oligonucleotide comprising the nucleotide base sequence of xGCCGTCACCCCACCAACAAGCT (SEQ ID NO: 22); and
a second oligonucleotide comprising the nucleotide base sequence of xGGGATAAGCCTGGGAAACTGGGTCTAATACC (SEQ ID NO: 2),
wherein x is nothing or is a sequence recognized by an RNA polymerase, and wherein each said oligonucleotide is from 22 to 100 bases in length.
2. An oligonucleotide for use in amplifying Mycobacterium tuberculosis nucleic acid, said oligonucleotide being from 22 to 100 nucleotide bases in length and comprising the nucleotide base sequence of xGCCGTCACCCCACCAACAAGCT (SEQ ID NO: 22) or a sequence of the same length and fully complementary thereto, wherein x is nothing or is a sequence recognized by an RNA polymerase.
3. A kit for use in amplifying and detecting Mycobacterium tuberculosis nucleic acid, said kit containing:
a first oligonucleotide of from 24 to 100 nucleotide bases in length and comprising the nucleotide base sequence of SEQ ID NO: 3; and
a second oligonucleotide of from 22 to 100 nucleotide bases in length and comprising the nucleotide base sequence of xGCCGTCACCCCACCAACAAGCT (SEQ ID NO: 22) or xGGGATAAGCCTGGGAAACTGGGTCTAATACC (SEQ ID NO: 2), wherein x is nothing or is a sequence recognized by an RNA polymerase.
4. A kit for use in amplifying and detecting Mycrcobacterium tuberculosis nucleic acid, said kit containing:
a first oligonucleotide of from 23 to 100 nucleotide bases in length and comprising the nucleotide base sequence of SEQ ID NO: 8; and
a second oligonucleotide of from 20 to 100 nucleotide bases in length and comprising the nucleotide base sequence of xCCAGGCCACTTCCOCTAACC (SEQ ID NO: 23) or xCGCGGAACAGGCTAAACCGCACGC (SEQ ID NO: 7), wherein x is nothing or is a sequence recognized by an RNA polymerase.
5. The kit of claim 3 , wherein said second oligonucleotide has a 3′ end which is modified to reduce or block extension of said second oligonucleotide by a polymerase.
6. The kit of claim 5 further comprising a third oligonucleotide having a 3′ end which is unmodified, wherein said third oligonucleotide is from 20 to 100 nucleotide bases in length and comprises the nucleotide base sequence of xCCAGGCCACTTCCOCTAACC (SEQ TD NO: 23) or xCGCGGAACAGGCTAAACCGCACGC (SEQ ID NO: 7), wherein x is nothing or is a sequence recognized by an RNA polymerase, and wherein the nucleotide base sequences of said second and third oligonucleotides are different.
7. The oligonucleotide of claim 2 , wherein said oligonucleotide has a 3′ end which is modified to reduce or block extension of said oligonucleotide by a polymerase.
8. A composition comprising:
a first oligonucleotide in accordance with said oligonucleotide of claim 2 , wherein said first oligonucleotide has a 3′ end which is not modified to reduce or block extension of said first oligonucleotide by a polymerase; and
a second oligonucleotide in accordance with said oligonucleotide of claim 2 , wherein said second oligonucleotide has a 3′ end which is modified to reduce or block extension of said second oligonucleotide by a polymerase.
9. The composition of claim 8 further comprising a third oligonucleotide having a 3′ end which is modified to reduce or block extension by a polymerase, wherein the 3′ ends of said second and third oligonucleotides are differently modified.
10. The kit of claim 4 , wherein said second oligonucleotide has a 3′ end which is modified to reduce or block extension of said second oligonucleotide by a polymerase.
11. The kit of claim 10 further comprising a third oligonucleotide having a 3′ end which is not modified to reduce or block extension of said third oligonucleotide by a polymerase.
12. A primer oligonucleotide up to 100 nucleotide bases in length which hybridizes to a nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid under amplification reaction conditions, wherein the nucleotide base sequence of said region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO: 22, the RNA equivalent thereof, and sequences of the same length and fully complementary thereto, and wherein said primer oligonucleotide includes an at least 10 contiguous nucleotide base sequence which is fully complementary to an at least 10 contiguous nucleotide base sequence contained within said region.
13. The primer oligonucleotide of claim 12 , said primer being from 15 to 50 nucleotide bases in length.
14. The primer oligonucleotide of claim 12 , wherein said primer oligonucleotide comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said region.
15. The primer oligonucleotide of claim 12 , wherein the nucleotide base sequence of said primer oligonucleotide consists of a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said region and, optionally, a sequence recognized by an RNA polymerase.
16. The primer oligonucleotide of claim 12 further comprising a sequence recognized by an RNA polymerase.
17. The primer oligonucleotide of claim 16 , said primer oligonucleotide comprising the nucleotide base sequence of SEQ ID NO: 1.
18. The primer oligonucleotide of claim 16 , wherein the nucleotide base sequence of said primer oligonucleotide consists of or is contained within the nucleotide base sequence of SEQ ID NO: 1.
19. A composition for use in amplifying Mycobacterium tuberculosis nucleic acid, said composition comprising:
a first primer oligonucleotide consisting of an oligonucleotide up to 100 nucleotide bases in length which hybridizes to a first nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid under amplification reaction conditions, wherein the nucleotide base sequence of said first region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO:23, the RNA equivalent thereof, and sequences of the same length and fully complementary thereto, and wherein said first primer oligonucleotide includes an at least 10 contiguous nucleotide base sequence which is fully complementary to an at least 10 contiguous nucleotide base sequence contained within said first region; and
a second primer oligonucleotide consisting of an oligonucleotide up to 100 nucleotide bases in length which hybridizes to a second nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid under amplification reaction conditions, wherein the nucleotide base sequence of said second region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO: 7, the RNA equivalent thereof, and sequences of the same length and fully complementary thereto, and wherein said second primer oligonucleotide includes an at least 10 contiguous nucleotide base sequence which is fully complementary to an at least 10 contiguous nucleotide base sequence contained within said second region.
20. The composition of claim 19 , wherein at least one of said first and second primer oligonucleotides further comprises a nucleotide base sequence which is recognized by an RNA polymerase which initiates transcription.
21. The composition of claim 19 further comprising a hybridization probe of from 10 to 100 nucleotide bases in length which hybridizes with specificity to at least 10 contiguous bases of a third nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid to form a detectable duplex under reaction conditions, wherein the nucleotide base sequence of said third region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO: 8, the RNA equivalent thereof, and sequences ofihe same length and fully complementary thereto.
22. The composition of claim 21 , wherein said probe comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said third region.
23. The composition of claim 21 , wherein said probe further comprises a detectable label.
24. The composition of claim 23 , wherein said detectable label is an acridinium ester.
25. A composition for use in amplifying Mycobacterium tuberculosis nucleic acid, said composition comprising first and second primer oligonucleotides, each of said primer oligonucleotides being up to 100 nucleotide bases in length,
wherein said first primer oligonucleotide hybridizes to a first nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid under amplification reaction conditions, and wherein the nucleotide base sequence of said first region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO: 22, the RNA equivalent thereof, and sequences of the same length and fully complementary thereto, and wherein said first primer oligonucleotide includes an at least 10 contiguous nucleotide base sequence which is fully complementary to an at least 10 contiguous nucleotide base sequence contained within said first region, and
wherein said second primer oligonucleotide hybridizes to a second nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid under amplification reaction conditions, and wherein the nucleotide base sequence of said second region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO: 2, the RNA equivalent thereof, and sequences of the same length and fully complementary thereto, and wherein said second primer oligonucleotide includes an at least 10 contiguous nucleotide base sequence which is fully complementary to an at least 10 contiguous nucleotide base sequence contained within said second region.
26. The composition of claim 25 , wherein:
said first primer oligonucleotide comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said first region; and
wherein said second primer oligonucleotide comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said second region.
27. The composition of claim 25 or 26 , wherein at least one of said first and second primer oligonucleotides further comprises a nucleotide base sequence which is recognized by an RNA polymerase which initiates transcription.
28. The composition of claim 25 or 26 further comprising a hybridization probe of from 10 to 100 nucleotide bases in length which hybridizes with specificity to at least 10 contiguous bases of a third nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid to form a detectable duplex under reaction conditions, wherein the nucleotide base sequence of said third region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO: 3, the RNA equivalent thereof, and sequences of the same length and fully complementary thereto.
29. The composition of claim 26 , wherein:
said first primer oligonucleotide comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said first region;
said second primer oligonucleotide comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said second region; and
said probe comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said third region.
30. The composition of claim 26 , wherein said probe comprises a detectable label.
31. The composition of claim 30 wherein said detectable label is an acridinium ester.
32. A helper probe consisting essentially of a nucleotide sequence selected from the group consisting of SEQ ID NO:4 and SEQ ID NO:5.
33. A probe mix comprising:
a hybridization probe of from 10 to 100 nucleotide bases in length which hybridizes with specificity to at least 10 contiguous bases of a nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid to form a detectable hybridization duplex under reaction conditions, wherein the nucleotide base sequence of said region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO: 8, the RNA equivalent thereof, and sequences of the same length and fully complementary thereto; and
a helper oligonucleotide consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NO: 9 and SEQ ID NO: 10.
34. A probe mix comprising:
a hybridization probe of from 10 to 100 nucleotide bases in length which hybridizes with specificity to at least 10 contiguous bases of a nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid to form a detectable hybridization duplex under reaction conditions, wherein the nucleotide base sequence of said region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO: 3, the RNA equivalent thereof, and sequences of the same length and fully complementary thereto; and
a helper oligonucleotide consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NO: 4 and SEQ ID NO: 5.
35. A kit for use in amplifying Mycobacterium tuberculosis nucleic acid, said kit containing:
a first oligonucleotide comprising the nucleotide base sequence of xCCAGGCCACTTCCGCTAACC (SEQ ID NO: 23); and
a second oligonucleotide comprising the nucleotide base sequence of xCGCGGAACAGGCTAAACCGCACGC (SEQ ID NO: 7),
wherein x is nothing or is a sequence recognized by an RNA polymerase.
36. A composition for use in detecting the presence of Mycobacterium tuberculosis in a sample, said composition comprising:
a) a hybridization probe of from 10 to 100 nucleotide bases in length comprising a nucleotide base sequence which hybridizes with specificity to at least 10 contiguous bases of a first nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid, wherein the nucleotide base sequence of said first region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO: 3 and SEQ ID NO: 8, the RNA equivalents thereof, and sequences of the same length and fully complementary thereto; and
b) a primer oligonucleotide of from 10 to 100 nucleotide bases in length which hybridizes to a second nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid under amplification reaction conditions, wherein the nucleotide base sequence of said second region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 22 and SEQ ID NO: 23, the RNA equivalents thereof, and sequences of the same length and fully complementary thereto.
37. A composition comprising:
a first oligonucleotide comprising a first primer sequence able to hybridize at or near the 3′ end of a (+) target nucleic acid sequence, a 5′ promoter sequence, and a modification at or near the 3′ end of said first primer sequence which reduces or blocks extension of said first primer sequence by a polymerase compared to said first primer sequence not having said modification;
a second oligonucleotide comprising a second primer sequence able to hybridize at or near the 3′ end of said (+) target sequence, a 5′ promoter sequence, and an optionally present modification at or near the 3′ end of said second primer sequence which reduces or blocks extension of said second primer sequence by a polymerase compared to said second primer sequence not having said modification, wherein said second oligonucleotide hybridizes to said (+) target sequence in effectively the sane position as said first oligonucleotide, and wherein said modification to said second primer sequence, if present, is different than said modification to said first primer sequence;
a third oligonucleotide comprising a third primer sequence able to hybridize to the 3′ end of a (−) target nucleic acid sequence which is the complement of said (+) target sequence, an optionally present 5′ promoter sequence, and an optionally present modification at or near the 3′ end of said third primer sequence which reduces or blocks extension of said third primer sequence by a polymerase compared to said third primer sequence not having said modification;
an enzyme selected from the group consisting of a DNA-dependent DNA polymerase and an RNA-dependent DNA polymerase; and
one or more RNA polymerases that recognize said promoter sequence of said first and second oligonucleotides.
38. The composition of claim 37 , wherein said (+) target sequence is RNA.
39. The composition of claim 37 , wherein said composition further comprises RNAse H activity.
40. The composition of claim 39 , wherein said RNAse H activity is supplied by an exogenous RNAse H from E. coli.
41. The composition of claim 39 , wherein said RNAse H activity is supplied by a reverse transcriptase.
42. The composition of claim 37 , wherein said enzyme is a reverse transcriptase which is both a DNA-dependent DNA polymerase and an RNA-dependent DNA polymerase.
43. The composition of claim 37 further comprising a molecule selected from the group consisting of DMSO, dimethylformamide, ethylene glycol, zinc and glycerol.
44. The composition of claim 37 further comprising a helper oligonucleotide.
45. The composition of claim 37 , wherein said first and said second oligonucleotides are present in a molar ratio of between 1:1 and 1000:1.
46. The composition of claim 37 , wherein said second primer sequence comprises said modification at or near its 3′ end.
47. The composition of claim 46 further comprising a fourth oligonucleotide comprising a fourth primer sequence that hybridizes in effectively the same position as said first and second oligonucleotides and an optionally present 5′ promoter sequence, wherein said fourth primer sequence does not contain a modification at or near its 3′ end which reduces or blocks extension of said fourth primer sequence.
48. The composition of claim 46 , wherein the 3′ end modifications to said first and second primer sequences are independently selected from the group consisting of an alkane dial modification, a 3′ deoxynucleotide residue, a nucleotide with a nonphosphodiester linkage, a non-nucleotide modification, a base non-complementary to said target sequence, and a dideoxynucleotide.
49. The composition of claim 46 , wherein the 3′ end modifications to said first and second primer sequences are independently selected from the group consisting of cordycepin, a ribonucleotide, and a phosphorothioate nucleotide.
50. The composition of claim 37 , wherein said third primer sequence does not comprise said modification at or near its 3′ end.
51. The composition of claim 37 , wherein said third oligonucleotide comprises said 5′ promoter sequence.
52. The composition of claim 51 , wherein said third primer sequence comprises said modification at or near its 3′ end.
53. The composition of claim 37 , wherein said first and second primer sequences are the same.
54. The composition of claim 37 , wherein said first and second primer sequences are different.
55. A composition comprising:
a first oligonucleotide comprising a first primer sequence able to hybridize to the 3′ end of a (+) target nucleic acid sequence, an optionally present 5′ promoter sequence, and an optionally present modification at or near the 3′ end of said first primer sequence which reduces or blocks extension of said first primer sequence by a polymerase compared to said first primer sequence not having said modification;
a second oligonucleotide comprising a second primer sequence able to hybridize at or near the 3′ end of a (−) target nucleic acid sequence which is the complement of said (+) target sequence, a 5′ promoter sequence, and a modification at or near the 3′ end of said second primer sequence which reduces or blocks extension of said second primer sequence by a polymerase compared to said second primer sequence not having said modification;
a third oligonucleotide comprising a third primer sequence able to hybridize at or near the 3′ end of said (−) target sequence, a 5′ promoter sequence, and an optionally present modification at or near the 3′ end of said third primer sequence which reduces or blocks extension of said third primer sequence by a polymerase compared to said third primer sequence not having said modification, wherein said third oligonucleotide hybridizes to said (−) target sequence in effectively the same position as said second oligonucleotide, and wherein said modification to said third oligonucleotide, if present, is different than said modification to said second oligonucleotide;
an enzyme selected from the group consisting of DNA-dependent DNA polymerase and RNA-dependent DNA polymerase; and
one or more RNA polymerases that recognize said promoter sequences of said first and second oligonucleotides.
56. The composition of claim 55 , wherein said (+) target sequences RNA.
57. The composition of claim 55 , wherein said composition further comprises RNAse H activity.
58. The composition of claim 57 , wherein said RNAse H activity is supplied by an exogenous RNAse H from E. coli.
59. The composition of claim 57 , wherein said RNAse H activity is supplied by a reverse transcriptase.
60. The composition of claim 55 , wherein said enzyme is a reverse transcriptase which is both a DNA-dependent DNA polymerase and an RNA-dependent DNA polymerase.
61. The composition of claim 55 further comprising a molecule selected from the group consisting of DMSO, dimethylformamide, ethylene glycol, zinc and glycerol.
62. The composition of claim 55 further comprising a helper oligonucleotide.
63. The composition of claim 55 , wherein said second and said third oligonucleotides are present in a molar ratio of between 1:1 and 1000:1.
64. The composition of claim 55 , wherein said third primer sequence comprises said modification at its 3′ end.
65. The composition of claim 64 further comprising a fourth oligonucleotide comprising a fourth primer sequence that hybridizes in effectively the same position as said second and third oligonucleotides and an optionally present 5′ promoter sequence, wherein said fourth primer sequence does not comprise a modification at or near its 3′ end which reduces or blocks primer extension of said fourth primer sequence.
66. The composition of claim 64 , wherein said 3′ end modifications to said second and third primer sequences are independently selected from the group consisting of an alkane diol modification, a 3′ deoxynucleotide residue, a nucleotide with a nonphosphodiester linkage, a non-nucleotide modification, a base non-complementary to said target sequence, and a dideoxynucleotide.
67. The composition of claim 64 , wherein the 3′ end modifications to said second and third primer sequences are independently selected from the group consisting of cordycepin, a ribonucleotide, and a phosphorothioate nucleotide.
68. The composition of claim 55 , wherein said first primer sequence does not comprise said modification at or near its 3′ end.
69. The composition of claim 55 , wherein said first oligonucleotide comprises said 5′ promoter sequence.
70. The composition of claim 55 , wherein said first primer sequence comprises said modification at or near its 3′ end.
71. The composition of claim 69 , wherein said promoter sequences of said first, second and third oligonucleotides are the same.
72. The composition of claim 55 , wherein said promoter sequences of said second and third primer sequences are the same.
73. The composition of claim 55 , wherein said promoter sequences of said second and said third primer sequences are different.
74. A kit comprising:
a first oligonucleotide comprising a first primer sequence able to hybridize at or near the 3′ end of a (+) target nucleic acid sequence, a 5′ promoter sequence, and a modification at or near the 3′ end of said first primer sequence which reduces or blocks extension of said first primer sequence by a polymerase compared to said first primer sequence not having said modification;
a second oligonucleotide comprising a second primer sequence able to hybridize at or near the 3′ end of said (+) target sequence, a 5′ promoter sequence, and an optionally present modification at or near the 3′ end of said second primer sequence which reduces or blocks extension of said second primer sequence by a polymerase compared to said second primer sequence not having said modification, wherein said second oligonucleotide hybridizes to said (+) target sequence in effectively the same position as said first oligonucleotide, and wherein said modification to said second primer sequence, if present, is different than said modification to said first primer sequence;
a third oligonucleotide comprising a third primer sequence able to hybridize to the 3′ end of a (−) target nucleic acid sequence which is the complement of said (+) target sequence, an optionally present 5′ promoter sequence, and an optionally present modification at or near the 3′ end of said third primer sequence which reduces or blocks extension of said third primer sequence by a polymerase compared to said third primer sequence not having said modification;
an enzyme selected from the group consisting of DNA-dependent DNA polymerase and RNA-dependent DNA polymerase; and
one or more RNA polymerases that recognize said promoter sequences of said first and second oligonucleotides.
75. The kit of claim 74 further comprising a hybridization probe able to indicate the presence of said (+) target sequence or said (−) target sequence.
76. A kit comprising:
a first oligonucleotide comprising a first primer sequence able to hybridize to the 3′ end of a (+) target nucleic acid sequence, an optionally present 5′ promoter sequence, and an optionally present modification at or near the 3′ end of said first primer sequence which reduces or blocks extension of said first primer sequence by a polymerase compared to said first primer sequence not having said modification,
a second oligonucleotide comprising a second primer sequence able to hybridize at or near the 3′ end of a (−) target nucleic acid sequence which is the complement of said (+) target sequence, a 5′ promoter sequence, and a modification at or near the 3′ end of said second primer sequence which reduces or blocks extension of said second primer sequence by a polymerase compared to said second primer sequence not having said modification;
a third oligonucleotide comprising a third primer sequence able to hybridize at or near the 3′ end of said (−) target sequence, a 5′ promoter sequence, and an optionally present modification at or near the 3′ end of said third primer sequence which reduces or blocks extension of said third primer sequence by a polymerase compared to said third primer sequence not having said modification, wherein said third oligonucleotide hybridizes to said (−) target sequence in effectively the same position as said second oligonucleotide and said modification to said third oligonucleotide, if present, is different than said modification to said second oligonucleotide;
an enzyme selected from the group consisting of DNA-dependent DNA polymerase and RNA-dependent DNA polymerase; and
one or more RNA polymerases that recognize said promoter sequences of said first and second oligonucleotides.
77. The kit of claim 76 further comprising a hybridization probe able to indicate the presence of said (+) target sequence or said (−) target sequence.
78. An oligonucleotide for use in amplifying Mycobacterium tuberculosis nucleic acid, said oligonucleotide being from 20 to 100 nucleotide bases in length and comprising the nucleotide base sequence of xCCAGGCCACTTCCGCTAACC (SEQ ID NO: 23) or a sequence of the same length and fully complementary thereto, wherein x is nothing or a sequence recognized by an RNA polymerase.
79. The composition of claim 78 , wherein said oligonucleotide has a 3′ end which is modified to reduce or block extension of said oligonucleotide by a polymerase.
80. A composition comprising:
a first oligonucleotide having a 3′ end which is not modified to reduce or block extension of said first oligonucleotide by a polymerase; and
a second oligonucleotide having a 3′ end which is modified to reduce or block extension of said second oligonucleotide by a polymerase, wherein each of said first and second oligonucleotides comprises a nucleotide base sequence selected from the group consisting of the nucleotide base sequences of xCCAGGCCACTTCCGCTAACC (SEQ ID NO: 23), xCGCGGAACAGGCTAAACCGCACGC (SEQ ID NO: 7), and sequences of the same length and fully complementary thereto, wherein x is nothing or a sequence recognized by an RNA polymerase.
81. The composition of claim 80 further comprising a third oligonucleotide having a 3′ end which is modified to reduce or block extension of said third oligonucleotide by a polymerase, wherein the 3′ ends of said second and third oligonucleotides are differently modified.
82. A primer oligonucleotide up to 100 nucleotide bases in length which hybridizes to a nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid under amplification reaction conditions, wherein the nucleotide base sequence of said region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO: 23, the RNA equivalent thereof, and sequences of the same length and fully complementary thereto, and wherein said primer oligonucleotide includes an at least 10 contiguous nucleotide base sequence which is fully complementary to an at least 10 contiguous nucleotide base sequence contained within said region.
83. The primer oligonucleotide of claim 82 , wherein said primer oligonucleotide is from 15 to 50 nucleotide bases in length.
84. The primer oligonucleotide of claim 82 , wherein said primer oligonucleotide is from 20 to 100 nucleotide bases in length.
85. The primer oligonucleotide of claim 14 , wherein said primer oligonucleotide is from 22 to 100 nucleotide bases in length.
86. The primer oligonucleotide of claim 82 , wherein said primer oligonucleotide comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said region.
87. The primer oligonucleotide of claim 82 , wherein the nucleotide base sequence of said primer oligonucleotide is of the same length and fully complementary to the nucleotide base sequence of said region and, optionally, a sequence recognized by an RNA polymerase.
88. The primer oligonucleotide of claim 82 further comprising a nucleotide base sequence which is recognized by an RNA polymerase which initiates transcription.
89. The primer oligonucleotide of claim 88 , wherein said primer oligonucleotide comprises the nucleotide base sequence of SEQ ID NO: 6 or SEQ ID NO: 19.
90. The primer oligonucleotide of claim 88 , wherein the nucleotide base sequence of said primer oligonucleotide consists of or is contained within the nucleotide base sequence of SEQ ID NO: 6 or SEQ ID NO: 19.
91. The composition of claim 23 further comprising:
a first helper oligonucleotide comprising the nucleotide base sequence of SEQ ID NO: 9; and
a second helper oligonucleotide comprising the nucleotide base sequence of SEQ ID NO: 10.
92. The composition of claim 36 further comprising a helper oligonucleotide comprising a nucleotide base sequence selected from the group consisting of the nucleotide base sequences of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 9 and SEQ ID NO: 10, and sequences of the same length and fully complementary thereto.
93. A kit comprising a primer oligonucleotide up to 100 nucleotide bases in length which hybridizes to a nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid under amplification reaction conditions, wherein the nucleotide base sequence of said region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO: 22 and SEQ ID NO: 23, the RNA equivalents thereof, and sequences of the same length and fully complementary thereto, and wherein said oligonucleotide primer includes an at least 10 contiguous nucleotide base sequence which is fully complementary to an at least 10 contiguous nucleotide base sequence contained within said region.
94. A composition for use in detecting the presence of Mycobacterium tuberculosis in a sample, said composition comprising:
a) a hybridization probe of from 10 to 100 nucleotide bases in length comprising a nucleotide base sequence which hybridizes with specificity to at least 10 contiguous bases of a first nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid under reaction conditions, wherein the nucleotide base sequence of said first region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO: 3, the RNA equivalent thereof, and sequences of the same length and fully complementary thereto; and
b) a primer oligonucleotide of from 10 to 100 nucleotide bases in length which hybridizes to a second nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid under amplification reaction conditions, wherein the nucleotide base sequence of said second region is selected from the group consisting the nucleotide base sequences of SEQ ID NO: 22 and SEQ ID NO: 2, the RNA equivalents thereof, and sequences of the same length and fully complementary thereto.
95. The composition of claim 94 further comprising a helper oligonucleotide comprising a nucleotide base sequence selected from the group consisting of the nucleotide base sequences of SEQ ID NO: 4 and SEQ ID NO: 5, and sequences of the same length and fully complementary thereto.
96. A kit comprising a primer oligonucleotide up to 100 nucleotide bases in length which hybridizes to a first nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid under amplification reaction conditions, wherein the nucleotide base sequence of said first region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO: 22, the RNA equivalent thereof, and sequences of the same length and fully complementary thereto, and wherein said primer oligonucleotide includes an at least 10 contiguous nucleotide base sequence which is fully complementary to an at least 10 contiguous nucleotide base sequence contained within said first region.
97. A composition for use in detecting the presence of Mycobacterium tuberculosis in a sample, said composition comprising:
a) a hybridization probe of from 10 to 100 nucleotide bases in length comprising a nucleotide base sequence which hybridizes with specificity to at least 10 contiguous bases of a first nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid under reaction conditions, wherein the nucleotide base sequence of said first region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO: 8, the RNA equivalent thereof, and sequences of the same length and fully complementary thereto; and
b) a primer oligonucleotide of from 10 to 100 nucleotide bases in length which hybridizes to a second nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid under amplification reaction conditions, wherein the nucleotide base sequence of said second region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO: 23 and SEQ ID NO: 7, the RNA equivalents thereof, and sequences of the same length and fully complementary thereto.
98. The composition of claim 97 further comprising a helper oligonucleotide comprising a nucleotide base sequence selected from the group consisting the nucleotide base sequences of SEQ ID NO: 9 and SEQ ID NO: 10, and sequences of the same length and fully complementary thereto.
99. A kit comprising a primer oligonucleotide up to 100 nucleotide bases in length which hybridizes to a nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid under amplification reaction conditions, wherein the nucleotide base sequence of said region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO: 23, the RNA equivalent thereof, and sequences of the same length and fully complementary thereto, and wherein said primer oligonucleotide includes an at least 10 contiguous nucleotide base sequence which is fully complementary to an at least 10 contiguous nucleotide base sequence contained within said region.
100. A composition comprising a specifically detectable nucleic acid hybrid formed under reaction conditions between a nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid, or a sequence of the same length and fully complementary thereto, and a hybridization probe at least 10 nucleotide bases in length, wherein the entire nucleotide base sequence of said probe hybridizes with specificity to said region, or a sequence of the same length and fully complementary thereto, and wherein the nucleotide base sequence of said region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO: 8, the RNA equivalent thereof, and sequences of the same length and fully complementary thereto.
101. The kit of claim 3 further comprising a helper oligonucleotide comprising a nucleotide base sequence selected from the group consisting of the nucleotide base sequences of SEQ ID NO: 4 and SEQ ID NO: 5, and sequences of the same length and fully complementary thereto.
102. The kit of claim 4 further comprising a helper oligonucleotide comprising a nucleotide base sequence selected from the group consisting of the nucleotide base sequences of SEQ ID NO: 9 and SEQ ID NO: 10, and sequences of the same length and fully complementary thereto.
103. The composition of claim 22 , wherein said probe further comprises a detectable label.
104. The composition of claim 103 , wherein said detectable label is an acridinium ester.
105. The composition of claim 103 further comprising:
a first helper oligonucleotide comprising the nucleotide base sequence of SEQ ID NO: 9; and
a second helper oligonucleotide comprising the nucleotide base sequence of SEQ ID NO: 10.
106. The kit of claim 96 further comprising a second primer oligonucleotide up to 100 nucleotide bases in length which hybridizes to a second nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid under amplification reaction conditions, wherein the nucleotide base sequence of said second region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO: 2, the RNA equivalent thereof, and sequences of the same length and fully complementary thereto, and wherein said second primer oligonucleotide includes an at least 10 contiguous nucleotide base sequence which is fully complementary to an at least 10 contiguous nucleotide base sequence contained within said second region.
107. The kit of claim 99 , wherein the nucleotide base sequence of said region is the nucleotide base sequence of SEQ ID NO: 23 or a sequence of the same length and fully complementary thereto.
108. A hybridization probe at least 10 nucleotide bases in length, wherein the entire nucleotide base sequence of said probe hybridizes with specificity to a nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid under reaction conditions, wherein the nucleotide base sequence of said region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO: 8, the RNA equivalent thereof, and sequences of the same length and fully complementary thereto.
109. An oligonucleotide at least 20 bases in length, wherein the nucleotide base sequence of said oligonucleotide consists of or is contained within the nucleotide base sequence xCGCGGAACAGCTAAACCGCACGC (SEQ ID NO: 7) or a sequence of the same length and fully complementary thereto, wherein x is nothing or a sequence recognized by an RNA polymerase.
110. A kit comprising a primer oligonucleotide at least 10 nucleotide bases in length, wherein the entire nucleotide base sequence of said primer hybridizes to a nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid under amplification reaction conditions, wherein the nucleotide base sequence of said region is selected from the group of nucleotide base sequences of SEQ ID NO: 7, the RNA equivalent thereof, and sequences of the same length and fully complementary thereto.
111. The kit of claim 1 , wherein each of said first and second oligonucleotides is up to 60 nucleotide bases in length.
112. The kit of claim 1 , wherein:
the nucleotide base sequence of said first oligonucleotide consists of the nucleotide base sequence of SEQ ID NO: 22 and, optionally, a sequence recognized by an RNA polymerase; and
the nucleotide base sequence of said second oligonucleotide consists of the nucleotide base sequence of SEQ ID NO: 2 and, optionally, a sequence recognized by an RNA polymerase.
113. The oligonucleotide of claim 2 , wherein said oligonucleotide is up to 60 nucleotide bases in length.
114. The oligonucleotide of claim 2 , wherein the nucleotide base sequence of said oligonucleotide consists of the nucleotide base sequence of SEQ ID NO: 22 and, optionally, a sequence recognized by an RNA polymerase.
115. The kit of claim 3 , wherein:
the nucleotide base sequence of said first oligonucleotide consists of the nucleotide base sequence of SEQ ID NO: 3; and
the nucleotide base sequence of said second oligonucleotide consists of the nucleotide base sequence of SEQ ID NO: 22 or SEQ ID NO: 2 and, optionally, a sequence recognized by an RNA polymerase.
116. The kit of claim 4 , wherein:
the nucleotide base sequence of said first oligonucleotide consists of the nucleotide base sequence of SEQ ID NO: 8; and
the nucleotide base sequence of said second oligonucleotide consists of the nucleotide base sequence of SEQ ID NO: 23 or SEQ ID NO: 7 and, optionally, a sequence recognized by an RNA polymerase.
117. The primer oligonucleotide of claim 18 , wherein the nucleotide base sequence of said primer oligonucleotide consists of the nucleotide base sequence of SEQ ID NO: 1.
118. The composition of claim 19 , wherein each of said first and second primer oligonucleotides is up to 60 nucleotide bases in length.
119. The composition of claim 19 , wherein:
said first primer oligonucleotide comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said first region; and
said second primer oligonucleotide comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said second region.
120. The composition of claim 19 , wherein:
the nucleotide base sequence of said first primer oligonucleotide consists of a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said first region and, optionally, a sequence recognized by an RNA polymerase; and
the nucleotide base sequence of said second primer oligonucleotide consists of a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said second region and, optionally, a sequence recognized by an RNA polymerase.
121. The composition of claim 19 , wherein:
said first primer oligonucleotide comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said first region;
said second primer oligonucleotide comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said second region; and
said probe comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said third region.
122. The composition of claim 19 , wherein:
the nucleotide base sequence of said first primer oligonucleotide consists of a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said first region and, optionally, a sequence recognized by an RNA polymerase;
the nucleotide base sequence of said second primer oligonucleotide consists of a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said second region and, optionally, a sequence recognized by an RNA polymerase; and
the nucleotide base sequence of said probe consists of a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said third region.
123. The composition of claim 25 , wherein each of said first and second primer oligonucleotides is up to 60 nucleotide bases in length.
124. The composition of claim 25 , wherein:
the nucleotide base sequence of said first primer oligonucleotide consists of a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said first region and, optionally, a sequence recognized by an RNA polymerase; and
the nucleotide base sequence of said second primer oligonucleotide consists of a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said second region and, optionally, a sequence recognized by an RNA polymerase.
125. The composition of claim 28 , wherein:
the nucleotide base sequence of said first primer oligonucleotide consists of a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said first region and, optionally, a sequence recognized by an RNA polymerase;
the nucleotide base sequence of said second primer oligonucleotide consists of a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said second region and, optionally, a sequence recognized by an RNA polymerase; and
the nucleotide base sequence of said probe consists of a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said third region.
126. The probe mix of claim 33 , wherein said probe comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said region.
127. The probe mix of claim 33 , wherein the nucleotide base sequence of said probe is of the same length and fully complementary to the nucleotide base sequence of said region.
128. The probe mix of claim 34 , wherein said probe comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said region.
129. The probe mix of claim 34 , wherein the nucleotide base sequence of said probe is of the same length and fully complementary to the nucleotide base sequence of said region.
130. The kit of claim 35 , wherein:
the nucleotide base sequence of said first oligonucleotide consists of the nucleotide base sequence of SEQ ID NO: 23 and, optionally, a sequence recognized by an RNA polymerase; and
the nucleotide base sequence of said second oligonucleotide consists of the nucleotide base sequence of SEQ ID NO: 7 and, optionally, a sequence recognized by an RNA polymerase.
131. The composition of claim 36 , wherein:
said probe comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said first region; and
said primer oligonucleotide comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said second region.
132. The composition of claim 36 , wherein:
the nucleotide base sequence of said probe is of the same length and fully complementary to the nucleotide base sequence of said first region; and
the nucleotide base sequence of said primer oligonucleotide consists of a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said second region and, optionally, a sequence recognized by an RNA polymerase.
133. The oligonucleotide of claim 78 , wherein said oligonucleotide is up to 60 nucleotide bases in length.
134. The composition of claim 78 , wherein the nucleotide base sequence of said oligonucleotide consists of the nucleotide base sequence of SEQ ID NO: 23 and, optionally, a sequence recognized by an RNA polymerase.
135. The kit of claim 93 , wherein said primer oligonucleotide is up to 60 nucleotide bases in length.
136. The kit of claim 93 , wherein said primer oligonucleotide comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said region.
137. The kit of claim 93 , wherein the nucleotide base sequence of said primer oligonucleotide consists of a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said region and, optionally, a sequence recognized by an RNA polymerase.
138. The composition of claim 94 , wherein:
said probe comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said first region; and
said primer oligonucleotide comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said second region.
139. The composition of claim 94 , wherein:
the nucleotide base sequence of said probe is of the same length and fully complementary to the nucleotide base sequence of said first region; and
the nucleotide base sequence of said primer oligonucleotide consists of a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said second region and, optionally, a sequence recognized by an RNA polymerase.
140. The kit of claim 96 , wherein said primer oligonucleotide is up to 60 nucleotide bases in length.
141. The kit of claim 96 , wherein said primer oligonucleotide comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said first region.
142. The kit of claim 96 , wherein the nucleotide base sequence of said primer oligonucleotide consists of a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said first region and, optionally, as sequence recognized by an RNA polymerase.
143. The composition of claim 97 , wherein:
said probe comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said first region; and
said primer oligonucleotide comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said second region.
144. The composition of claim 97 , wherein:
the nucleotide base sequence of said probe is of the same length and fully complementary to the nucleotide base sequence of said first region, and
the nucleotide base sequence of said primer oligonucleotide consists of a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said second region and, optionally, a sequence recognized by an RNA polymerase.
145. The kit of claim 99 , wherein said primer oligonucleotide comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said region.
146. The kit of claim 99 , wherein the nucleotide base sequence of said primer oligonucleotide consists a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said region and, optionally, a sequence recognized by an RNA polymerase.
147. The composition of claim 100 , wherein said probe comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said region.
148. The composition of claim 100 , wherein the nucleotide base sequence of said probe is of the same length and fully complementary to the nucleotide base sequence of said region.
149. The kit of claim 106 , wherein each of said first and second primer oligonucleotides is up to 60 nucleotide bases in length.
150. The kit of claim 106 , wherein:
said first primer oligonucleotide comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said first region; and
said second primer oligonucleotide comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said second region.
151. The kit of claim 106 , wherein:
the nucleotide base sequence of said first primer oligonucleotide consists of a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said first region and, optionally, a sequence recognized by an RNA polymerase; and
the nucleotide base sequence of said second primer oligonucleotide consists of a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said second region and, optionally, a sequence recognized by an RNA polymerase.
152. The probe of claim 108 , wherein said probe comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said region.
153. The probe of claim 108 , wherein the nucleotide base sequence of said probe is of the same length and fully complementary to the nucleotide base sequence of said region.
154. The oligonucleotide of claim 109 , wherein the nucleotide base sequence of said oligonucleotide consists of the nucleotide base sequence of SEQ ID NO: 7.
155. The kit of claim 110 , wherein said primer oligonucleotide comprises a nucleotide base sequence of the same length and fully complementary to the nucleotide base sequence of said region.
156. The kit of claim 110 , wherein the nucleotide base sequence of said primer oligonucleotide is of the same length and fully complementary to the nucleotide base sequence of said region and, optionally, a sequence recognized by an RNA polymerase.