Molecular interaction sites of interleukin-2 RNA and methods of modulating the same
View Patent ↗Methods for the identification of compounds which modulate, either inhibit or stimulate, biomolecules are provided. Nucleic acids, especially RNAs are preferred substrates for such modulation. The present methods are particularly powerful in that they provide novel combinations of techniques which give rise to compounds, usually “small” organic compounds, which are highly potent modulators of RNA and other biomolecular activity. In accordance with preferred aspects of the invention, very large numbers of compounds may be tested essentially simultaneously to determine whether they are likely to interact with a molecular interaction site and modulate the activity of the biomolecule. Pharmaceuticals, veterinary drugs, agricultural chemicals, industrial chemicals, research chemicals and many other beneficial compounds may be identified in accordance with embodiments of this invention.
1. A purified and isolated RNA fragment up to 70 nucleotides that is conserved across at least two species comprising the sequence NNNGAUNCUUUNNGUAAGCCCNANGNGNN (SEQ ID NO:23).
2. A purified and isolated RNA fragment up to 70 nucleotides comprising the human sequence UAUGAUUCUUUUUGUAAGCCCUAGGGGCU(SEQ ID NO:24).
3. A purified and isolated RNA fragment up to 70 nucleotides comprising the mouse sequence AAAGAUUCUUUUUGUAACCCCCAAGGGCU (SEQ ID NO:25).
4. A purified and isolated RNA fragment up to 70 nucleotides comprising the rat sequence AAAGAUUCUUUUUGUAAGCCCCAAGGGCU (SEQ ID NO:25).