Pharmaceutical compositions comprising a polynucleotide and optionally an antigen especially for vaccination
View Patent ↗The present invention relates to pharmaceutical compositions comprising at least one fragment of a polynucleotide, preferably at least one antigen, and optionally a pharmaceutically acceptable carrier and/or diluent. In accordance with the present invention was found that the introduction of the pharmaceutical composition into vertebrates will achieve regulation of growth, induction of cellular transcription and translation, protein synthesis, protein expression or protein secretion. The pharmaceutical compositions are useful in vaccination protocols but also in any other therapeutic situation in which immunomodulation is of benefit, such as sub-optimal immune responses, reaction to pathogens, tolerance or autoimmunity.
1. A pharmaceutical composition, comprising:
(a) at least one polynucleotide of a length of 100 nucleotides or less, wherein the polynucleotide comprises a sequence of a binding site for a transcription factor and which is selected from the group consisting of
GATTGCCTGACGTCAGAGAG
(SEQ ID NO:8),
+0
GGAATGACGTTCCCTGTG
(SEQ ID NO:9),
+0
AGCTATGACGTTCCAAGG
(SEQ ID NO:10),
+0
GCTTGATGACTCAGCCGGAA
(SEQ ID NO:11),
+0
TCGATCGGGGCGGGGCGAGC
(SEQ ID NO:12),
+0
TGCAGATTGCGCAATCTGCA
(SEQ ID NO:13),
+0
AGCGGGGGCGAGCGGGGGCG
(SEQ ID NO:14),
+0
GTCCATTTCCCGTAAATCTT
(SEQ ID NO:16),
+0
TATGCATATTCCTGTAAGTG
(SEQ ID NO:17),
+0
CTGATTTCCCCGAAATGATG
(SEQ ID NO:19),
+0
AGATTTCTAGGAATTCAATC
(SEQ ID NO:20),
+0
GTATTTCCCAGAAAAGGAAC
(SEQ ID NO:21),
+0
AAGCGAAAATGAAATTGACT
(SEQ ID NO:22), and
+0
CAGGCATAACGGTTCCGTAG
(SEQ ID NO:23);
(b) at least one antigen; and
(c) a pharmaceutically acceptable carrier and/or diluent.
2. The pharmaceutical composition according to claim 1 characterized in that the polynucleotide comprises at least one phosphorothioate linkage.
3. The pharmaceutical composition according to claim 1 , wherein the antigen is selected from the group consisting of peptides, polypeptides, proteins, polysaccharides, steroids, tumor cell antigens, and tumor cells.
4. The pharmaceutical composition according to claim 1 , wherein the polynucleotide comprises a sequence GATTGCCTGACGTCAGAGAG (SEQ ID NO:8).
5. The pharmaceutical composition according to claim 1 , wherein the polynucleotide comprises a sequence GGAATGACGTTCCCTGTG (SEQ ID NO:9).
6. The pharmaceutical composition according to claim 1 , wherein the polynucleotide comprises a sequence AGCTATGACGTTCCAAGG (SEQ ID NO:10).
7. The pharmaceutical composition according to claim 1 , wherein the polynucleotide comprises a sequence GCTTGATGACTCAGCCGGAA (SEQ ID NO:11).
8. The pharmaceutical composition according to claim 1 , wherein the polynucleotide comprises a sequence TCGATCGGGGCGGGGCGAGC (SEQ ID NO:12).
9. The pharmaceutical composition according to claim 1 , wherein the polynucleotide comprises a sequence TGCAGATTGCGCAATCTGCA (SEQ ID NO:13).
10. The pharmaceutical composition according to claim 1 , wherein the polynucleotide comprises a sequence AGCGGGGGCGAGCGGGGGCG (SEQ ID NO:14).
11. The pharmaceutical composition according to claim 1 , wherein the polynucleotide comprises a sequence GTCCATTTCCCGTAAATCTT (SEQ ID NO:16).
12. The pharmaceutical composition according to claim 1 , wherein the polynucleotide comprises a sequence TATGCATATTCCTGTAAGTG (SEQ ID NO:17).
13. The pharmaceutical composition according to claim 1 , wherein the polynucleotide comprises a sequence CTGATTTCCCCGAAATGATG (SEQ ID NO:19).
14. The pharmaceutical composition according to claim 1 , wherein the polynucleotide comprises a sequence AGATTTCTAGGAATTCAATC (SEQ ID NO:20).
15. The pharmaceutical composition according to claim 1 , wherein the polynucleotide comprises a sequence GTATTTCCCAGAAAAGGAAC (SEQ ID NO:21).
16. The pharmaceutical composition according to claim 1 , wherein the polynucleotide comprises a sequence AAGCGAAAATGAAATTGACT (SEQ ID NO:22).
17. The pharmaceutical composition according to claim 1 , wherein the polynucleotide comprises a sequence CAGGCATAACGGTTCCGTAG (SEQ ID NO:23).
18. The pharmaceutical composition according to claim 1 , wherein the polynucleotide is an oligonucleotide consisting of a sequence GATTGCCTGACGTCAGAGAG (SEQ ID NO:8).
19. The pharmaceutical composition according to claim 1 , wherein the polynucleotide is an oligonucleotide consisting of a sequence GGAATGACGTTCCCTGTG (SEQ ID NO:9).
20. The pharmaceutical composition according to claim 1 , wherein the polynucleotide is an oligonucleotide consisting of a sequence AGCTATGACGTTCCAAGG (SEQ ID NO:10).
21. The pharmaceutical composition according to claim 1 , wherein the polynucleotide is an oligonucleotide consisting of a sequence GCTTGATGACTCAGCCGGAA (SEQ ID NO:11).
22. The pharmaceutical composition according to claim 1 , wherein the polynucleotide is an oligonucleotide consisting of a sequence TCGATCGGGGCGGGGCGAGC (SEQ ID NO:12).
23. The pharmaceutical composition according to claim 1 , wherein the polynucleotide is an oligonucleotide consisting of a sequence TGCAGATTGCGCAATCTGCA (SEQ ID NO:13).
24. The pharmaceutical composition according to claim 1 , wherein the polynucleotide is an oligonucleotide consisting of a sequence AGCGGGGGCGAGCGGGGGCG (SEQ ID NO:14).
25. The pharmaceutical composition according to claim 1 , wherein the polynucleotide is an oligonucleotide consisting of a sequence GTCCATTTCCCGTAAATCTT (SEQ ID NO:16).
26. The pharmaceutical composition according to claim 1 , wherein the polynucleotide is an oligonucleotide consisting of a sequence TATGCATATTCCTGTAAGTG (SEQ ID NO:17).
27. The pharmaceutical composition according to claim 1 , wherein the polynucleotide is an oligonucleotide consisting of a sequence CTGATTTCCCCGAAATGATG (SEQ ID NO:19).
28. The pharmaceutical composition according to claim 1 , wherein the polynucleotide is an oligonucleotide consisting of a sequence AGATTTCTAGGAATTCAATC (SEQ ID NO:20).
29. The pharmaceutical composition according to claim 1 , wherein the polynucleotide is an oligonucleotide consisting of a sequence GTATTTCCCAGAAAAGGAAC (SEQ ID NO:21).
30. The pharmaceutical composition according to claim 1 , wherein the polynucleotide is an oligonucleotide consisting of a sequence AAGCGAAAATGAAATTGACT (SEQ ID NO:22).
31. The pharmaceutical composition according to claim 1 , wherein the polynucleotide is an oligonucleotide consisting of a sequence CAGGCATAACGGTTCCGTAG (SEQ ID NO:23).
32. The pharmaceutical composition according to any one of claims 4 – 17 , wherein the polynucleotide comprises at least one phosphorothioate linkage.
33. The pharmaceutical composition according to any one of claims 18 – 31 , wherein the oligonucleotide comprises at least one phosphorothioate linkage.
34. The pharmaceutical composition according to any one of claims 4 – 31 , wherein the antigen is selected from the group consisting of peptides, polypeptides, proteins, polysaccharides, steroids, tumor cell antigens, and tumor cells.