Antisense modulation of apolipoprotein (a) expression
View Patent ↗Antisense compounds, compositions and methods are provided for modulating the expression of apolipoprotein(a). The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding apolipoprotein(a). Methods of using these compounds for modulation of apolipoprotein(a) expression and for treatment of diseases associated with expression of apolipoprotein(a) are provided.
1. A non-cleaving antisense oligonucleotide 12 to 30 nucleobases in length, wherein said oligonucleotide
is targeted to nucleotides 174 to 203 of (SEQ ID NO:3),
is 100% complementary to SEQ ID NO: 3, and
comprises at least one modification selected from the group consisting of a modified internucleoside linkage, a modified sugar moiety, and a modified nucleobase.
2. The oligonucleotide of claim 1 wherein the modified internucleoside linkage is a phosphorothioate linkage.
3. The oligonucleotide of claim 1 wherein the modified sugar moiety is a 2′-O-methoxyethyl sugar moiety.
4. The oligonucleotide of claim 1 wherein the modified nucleobase is a 5-methylcytosine.
5. The oligonucleotide of claim 1 which is a chimeric oligonucleotide.
6. A composition comprising the oligonucleotide of claim 1 and a pharmaceutically acceptable carrier or diluent.
7. A method of inhibiting the expression of human apolipoprotein (a) in cells or tissues comprising contacting cells or tissues in vitro with the oligonucleotide of claim 1 so that expression of human apolipoprotein (a) is inhibited.
8. An antisense oligonucleotide 12 to 30 nucleobases in length, wherein said oligonucleotide comprises at least an 8-nucleobase portion of the nucleobase sequence of SEQ ID NO: 7 and is 100% complementary to a nucleic acid molecule encoding human apolipoprotein(a) (SEQ ID NO: 3).
9. The antisense oligonucleotide of claim 8 , wherein said oligonucleotide is 20 nucleobases in length.
10. The antisense oligonucleotide of claim 8 , wherein said oligonucleotide comprises the nucleobase sequence GGCAGGTCCTTCCTGTGACA (SEQ ID NO: 7).
11. The antisense oligonucleotide of claim 8 , wherein said oligonucleotide is a chimeric oligonucleotide.
12. The antisense oligonucleotide of claim 8 , wherein said oligonucleotide comprises at least one modified internucleoside linkage.
13. The antisense oligonucleotide of claim 12 , wherein the modified internucleoside linkage is a phosphorothioate linkage.
14. The antisense oligonueleotide of claim 8 , wherein said oligonucleotide comprises at least one modified sugar moiety.
15. The antisense oligonucleotide of claim 14 , wherein said modified sugar moiety is a 2′-O-methoxyethyl sugar moiety.
16. The antisense oligonucleotide of claim 8 , wherein said oligonucleotide comprises at least one modified nucleobase.
17. The antisense oligonucleotide of claim 16 , wherein said modified nucleobase is a 5-methylcytidine.
18. The antisense oligonucleotide of claim 8 , wherein said antisense oligonucleotide consists of the nucleobase sequence GGCAGGTCCTTCCTGTGACA (SEQ ID NO: 7).
19. The antisense oligonucleotide of claim 11 , wherein said chimeric oligonucleotide comprises a gap segment of linked 2′-deoxynucleotides which is flanked on each side by at least one 2′-O-methoxyethyl nucleotide.
20. The antisense oligonucleotide of claim 19 , wherein said gap segment is ten 2′-deoxynucleotides in length.
21. A composition comprising the antisense oligonucleotide of claim 8 , and a pharmaceutically acceptable carrier or diluent.
22. The antisense oligonucleotide of claim 8 , having at least 12 linked nucleobases of SEQ ID NO: 7.
23. The oligonucleotide of claim 1 , wherein said oligonucleotide is targeted to nucleotides 174 to 193 of SEQ ID NO: 3.
24. The oligonucleotide of claim 5 , wherein said oligonucleotide comprises a gap segment of linked 2′-deoxynucleotides which is flanked on each side by at least one 2′-O-methoxyethyl nucleotide.
25. The oligonucleotide of claim 24 , wherein said gap segment is ten 2′-dcoxynucleotides in length.