IP Library Granted Patent US 8,834,900
Granted Patent B2
US 8,834,900 · App. 10/224,523 · Granted Sep 16, 2014

Combination motif immune stimulatory oligonucleotides with improved activity

View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 8,834,900
App. No.
10/224,523
Granted
Sep 16, 2014
Kind
B2
Abstract

A class of immunostimulatory nucleic acids having at least two functionally and structurally defined domains is provided. This class of combination motif immunostimulatory nucleic acids activates an immune response and is useful for treating a variety of immune related disorders such as cancer, infectious disease, and allergic disorders. The nucleic acids also stimulate activation of natural killer cells and production of type 1 interferon.

Claims (42)

1. An isolated immunostimulatory nucleic acid of 14-100 nucleotides in length having a sequence comprising the formula:

5′ PX 1 DCGHX 2 3′ or 5′ X 1 DCGHX 2 P 3′

wherein X 1 and X 2 are independently any sequence 0 to 10 nucleotides long, D is a nucleotide other than C, C is unmethylated, H is a nucleotide other than G, and P is a GC-rich palindrome containing sequence at least 10 nucleotides long, wherein the immunostimulatory nucleic acid has a completely nuclease-resistant backbone such that each internucleotide linkage is modified, wherein at least one of a), or b) is in the nucleic acid:

a) P is completely palindromic, H is T, and X 2 is selected from the group consisting of CG, CGT, CGTTT, and CGTTTT, wherein when P is 12 nucleotides X 2 is not CGTTTT,

b) P includes at least one inosine.

2. The immunostimulatory nucleic acid of claim 1 , wherein the immunostimulatory nucleic acid comprises 5′ X 1 DCGHX 2 PX 3 3′, wherein X 3 is any sequence 0 to 10 nucleotides long.

3. The immunostimulatory nucleic acid of claim 1 , wherein the immunostimulatory nucleic acid comprises 5′ X 1 DCGHPX 3 3′, wherein X 3 is any sequence 0 to 10 nucleotides long.

4. The immunostimulatory nucleic acid of claim 1 , wherein the immunostimulatory nucleic acid comprises 5′ DCGHX 2 PX 3 3′, wherein X 3 is any sequence 0 to 10 nucleotides long.

5. The immunostimulatory nucleic acid of claim 1 , wherein the immunostimulatory nucleic acid comprises 5′ TCGHX 2 PX 3 3′, wherein X 3 is any sequence 0 to 10 nucleotides long.

6. The immunostimulatory nucleic acid of claim 1 , wherein the immunostimulatory nucleic acid comprises 5′ DCGHPX 3 3′, wherein X 3 is any sequence 0 to 10 nucleotides long.

7. The immunostimulatory nucleic acid of claim 1 , wherein the immunostimulatory nucleic acid comprises 5′ DCGHP 3′.

8. The immunostimulatory nucleic acid of claim 1 , wherein D is T.

9. The immunostimulatory nucleic acid of claim 1 , wherein H is T.

10. The immunostimulatory nucleic acid of claim 1 , wherein P is completely palindromic, H is T, and X2 is selected from the group consisting of CG, CGT, CGTTT, and CGTTTT.

11. The immunostimulatory nucleic acid of claim 10 , wherein H is T and X 2 is CG.

12. The immunostimulatory nucleic acid of claim 1 , wherein H is T and X 2 is CGTTT or CGTTTT.

13. An isolated immunostimulatory nucleic acid of 14-100 nucleotides in length having a sequence comprising the formula:

5′ PX 1 DCGHX 2 3′ or 5′ X 1 DCGHX 2 P 3′

wherein X 1 and X 2 are independently any sequence 0 to 10 nucleotides long, D is a nucleotide other than C, C is unmethylated, H is a nucleotide other than G, and P is a GC-rich palindrome containing sequence at least 10 nucleotides long, the immunostimulatory nucleic acid has a nuclease-resistant backbone and wherein:

H is T and X 2 is selected from the group consisting of CG, CGT, CGTT, CGTTT, and CGTTTT, and wherein P includes at least one inosine.

14. The immunostimulatory nucleic acid of claim 1 , wherein the immunostimulatory nucleic acid has a phosphorothioate backbone.

15. The immunostimulatory nucleic acid of claim 1 , further comprising a poly-T sequence at the 5′ end.

16. The immunostimulatory nucleic acid of claim 1 , further comprising a poly-T sequence at the 3′ end.

17. The immunostimulatory nucleic acid of claim 1 , wherein the immunostimulatory nucleic acid is 14-40 nucleotides in length.

18. The immunostimulatory nucleic acid of claim 1 , wherein the immunostimulatory nucleic acid is 14-30 nucleotides in length.

19. A pharmaceutical composition, comprising an immunostimulatory nucleic acid of claim 1 , and a pharmaceutically acceptable carrier.

20. A vaccine composition of an isolated immunostimulatory nucleic acid of 14-100 nucleotides in length having a sequence comprising the formula:

5′ NX 1 DCGHX 2 3′ or 5′ X 1 DCGHX 2 N 3′

wherein X 1 and X 2 are independently any sequence 0 to 10 nucleotides long, D is a nucleotide other than C, C is unmethylated, H is a nucleotide other than G, and N is a B-cell neutralizing sequence, wherein N begins with CGG and is at least 10 nucleotides long, wherein:

a) for 5′ NX 1 DCGHX 2 3′

H is T and X 2 is selected from the group consisting of CG, CGT, CGTT, CGTTT, and CGTTTT,

b) for 5′ X 1 DCGHX 2 N 3′

H is T and X 2 is selected from the group consisting of CG, CGT, CGTT, and CGTTT,

and wherein the immunostimulatory nucleic acid has a fully nuclease-resistant backbone, and an antigen.

21. The immunostimulatory nucleic acid of claim 20 , wherein N comprises at least four CG dinucleotides and no more than two CCG trinucleotides.

22. The immunostimulatory nucleic acid of claim 20 , wherein the immunostimulatory nucleic acid has a phosphorothioate backbone.

23. The immunostimulatory nucleic acid of claim 20 , further comprising a poly-T sequence at the 5′ end.

24. The immunostimulatory nucleic acid of claim 20 , further comprising a poly-T sequence at the 3′ end.

25. The immunostimulatory nucleic acid of claim 20 , wherein the immunostimulatory nucleic acid is 14-40 nucleotides in length.

26. The immunostimulatory nucleic acid of claim 20 , wherein the immunostimulatory nucleic acid is 14-30 nucleotides in length.

27. A pharmaceutical composition, comprising an immunostimulatory nucleic acid of claim 20 , and a pharmaceutically acceptable carrier.

28. An immunostimulatory nucleic, wherein the immunostimulatory nucleic acid is TCGTCGTTTTCGGCGGCCGCCG (SEQ ID NO: 4).

Assignments (2)
CONFIRMATION OF EXCLUSIVE PATENT LICENSE Recorded Dec 20, 2005
From: COLEY PHARMACEUTICAL GROUP, INC.; COLEY PHARMACEUTICAL GROUP, LTD.; COLEY PHARMACEUTICAL, GMBH
To: PFIZER INC.
Reel/Frame 017353/0372 →
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Dec 1, 2004
From: UHLMANN, EUGEN
To: COLEY PHARMACEUTICAL GMBH
Reel/Frame 015417/0266 →