Dog melanin-concentrating hormone receptor
View Patent ↗The present invention features polypeptides and nucleic acids related to a dog MCH receptor and uses of such polypeptides and nucleic acids. The dog MCH receptor is a G protein coupled receptor whose activity is stimulated by MCH binding.
1. A purified polypeptide comprising an amino acid region of SEQ. ID. NO. 1 selected from the group consisting of:
SEQ. ID. NO: 7
LEASLLPPGP,
SEQ. ID. NO. 8
SEGPDNLTSAGP,
SEQ. ID. NO. 9
RRTGNVSYIN,
SEQ. ID. NO. 10
PFPGGTVGCG, and
SEQ. ID. NO. 11
ILQRMMSSVA.
2. The polypeptide of claim 1 , wherein said polypeptide comprises the amino acid sequence of SEQ. ID. NO. 1.
3. The polypeptide of claim 2 , wherein said polypeptide consists of the amino acid sequence of SEQ. ID. NO. 1.
4. A purified nucleic acid comprising a nucleotide sequence encoding for the polypeptide of claim 1 .
5. A purified nucleic acid comprising a nucleotide sequence region of SEQ. ID. NO. 4 selected from the group consisting of:
SEQ. ID. NO. 12
CCTCGGAGGGCCCGGACAACC,
SEQ. ID. NO. 13
ACCTCTGCCGGGCCACCTCGT,
SEQ. ID. NO. 14
GCCCTTCGTGGTCATCACAGCCGCGTAT,
SEQ. ID. NO. 15
TGTCCTCGGTAGCCCCTGCCTCTCAA, and
SEQ. ID. NO. 16
TTCGAGCCGTCAGCAATGCT.
6. The purified nucleic acid of claim 5 , wherein said nucleic acid comprises the nucleotide sequence of SEQ ID NO: 4.
7. The purified nucleic acid of claim 6 , wherein said nucleic acid consists of the nucleotide sequence of SEQ ID NO: 4.
8. A nucleic acid comprising a recombinant nucleotide sequence encoding for a polypeptide comprising an amino acid region of SEQ. ID. NO. 1 selected from the group consisting of:
SEQ. ID. NO. 7
LEASLLPPGP,
SEQ. ID. NO. 8
SEGPDNLTSAGP,
SEQ. ID. NO. 9
RRTGNVSYIN,
SEQ. ID. NO. 10
PFPGGTVGCG, and
SEQ. ID. NO. 11
ILQRMMSSVA.
9. The nucleic acid of claim 8 , wherein said polypeptide comprises the amino acid sequence of SEQ ID NO:1.
10. The nucleic acid of claim 8 , wherein said polypeptide consists of the amino acid sequence of SEQ ID NO:1.
11. The nucleic acid of claim 8 , wherein said nucleic acid is an expression vector.
12. A recombinant cell comprising the expression vector of claim 11 .
13. A recombinant cell made by a process comprising the step of introducing into said cell the expression vector of claim 11 .
14. A method of measuring the ability of a test compound to affect MCH receptor activity comprising the steps of:
a) contacting a recombinant cell with said compound, wherein said recombinant cell comprises a recombinant nucleic acid expressing a functional MCH receptor that comprises the amino acid sequence of SEQ. ID. NO. 1; and
b) measuring MCH receptor activity.
15. The method of claim 14 , wherein said MCH receptor consists of the sequence of SEQ. ID. NO. 1.
16. The method of claim 15 , wherein said contacting further comprises contacting the cell with a MCH agonist to stimulate MCH receptor activity, and measuring the ability of said compound to modulate MCH receptor activity.