IP Library Granted Patent US 7,148,026
Granted Patent B2
US 7,148,026 · App. 10/333,379 · Granted Dec 12, 2006

Dog melanin-concentrating hormone receptor

View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 7,148,026
App. No.
10/333,379
Granted
Dec 12, 2006
Kind
B2
Abstract

The present invention features polypeptides and nucleic acids related to a dog MCH receptor and uses of such polypeptides and nucleic acids. The dog MCH receptor is a G protein coupled receptor whose activity is stimulated by MCH binding.

Claims (48)

1. A purified polypeptide comprising an amino acid region of SEQ. ID. NO. 1 selected from the group consisting of:

SEQ. ID. NO: 7

LEASLLPPGP,

SEQ. ID. NO. 8

SEGPDNLTSAGP,

SEQ. ID. NO. 9

RRTGNVSYIN,

SEQ. ID. NO. 10

PFPGGTVGCG, and

SEQ. ID. NO. 11

ILQRMMSSVA.

2. The polypeptide of claim 1 , wherein said polypeptide comprises the amino acid sequence of SEQ. ID. NO. 1.

3. The polypeptide of claim 2 , wherein said polypeptide consists of the amino acid sequence of SEQ. ID. NO. 1.

4. A purified nucleic acid comprising a nucleotide sequence encoding for the polypeptide of claim 1 .

5. A purified nucleic acid comprising a nucleotide sequence region of SEQ. ID. NO. 4 selected from the group consisting of:

SEQ. ID. NO. 12

CCTCGGAGGGCCCGGACAACC,

SEQ. ID. NO. 13

ACCTCTGCCGGGCCACCTCGT,

SEQ. ID. NO. 14

GCCCTTCGTGGTCATCACAGCCGCGTAT,

SEQ. ID. NO. 15

TGTCCTCGGTAGCCCCTGCCTCTCAA, and

SEQ. ID. NO. 16

TTCGAGCCGTCAGCAATGCT.

6. The purified nucleic acid of claim 5 , wherein said nucleic acid comprises the nucleotide sequence of SEQ ID NO: 4.

7. The purified nucleic acid of claim 6 , wherein said nucleic acid consists of the nucleotide sequence of SEQ ID NO: 4.

8. A nucleic acid comprising a recombinant nucleotide sequence encoding for a polypeptide comprising an amino acid region of SEQ. ID. NO. 1 selected from the group consisting of:

SEQ. ID. NO. 7

LEASLLPPGP,

SEQ. ID. NO. 8

SEGPDNLTSAGP,

SEQ. ID. NO. 9

RRTGNVSYIN,

SEQ. ID. NO. 10

PFPGGTVGCG, and

SEQ. ID. NO. 11

ILQRMMSSVA.

9. The nucleic acid of claim 8 , wherein said polypeptide comprises the amino acid sequence of SEQ ID NO:1.

10. The nucleic acid of claim 8 , wherein said polypeptide consists of the amino acid sequence of SEQ ID NO:1.

11. The nucleic acid of claim 8 , wherein said nucleic acid is an expression vector.

12. A recombinant cell comprising the expression vector of claim 11 .

13. A recombinant cell made by a process comprising the step of introducing into said cell the expression vector of claim 11 .

14. A method of measuring the ability of a test compound to affect MCH receptor activity comprising the steps of:

a) contacting a recombinant cell with said compound, wherein said recombinant cell comprises a recombinant nucleic acid expressing a functional MCH receptor that comprises the amino acid sequence of SEQ. ID. NO. 1; and

b) measuring MCH receptor activity.

15. The method of claim 14 , wherein said MCH receptor consists of the sequence of SEQ. ID. NO. 1.

16. The method of claim 15 , wherein said contacting further comprises contacting the cell with a MCH agonist to stimulate MCH receptor activity, and measuring the ability of said compound to modulate MCH receptor activity.

Assignments (1)
CHANGE OF NAME Recorded Jan 28, 2010
From: MERCK & CO., INC.
To: MERCK SHARP & DOHME CORP.
Reel/Frame 023861/0349 →