Method and kit for the diagnosis or treatment control of intestinal carcinoma
The invention relates to a diagnosis kit and to a method for the diagnosis or treatment control of intestinal carcinoma in a human being. According to the invention, the presence or absence of at least two different messenger-RNAs coding for several of the tumor marker proteins CK20, EGF-R, CEA, GA733.2, PDGF-β and/or stanniocalcin is detected in a human blood sample. The presence of intestinal tumor cells in the blood sample is then deduced therefrom, as is possible metastatic spread.
1 . A procedure for diagnosis or monitoring of intestinal cancer in a human, which procedure comprises detecting in a blood sample from the human the presence of absence of at least two different mRNAs, wherein each of the at least two different mRNAs code for a tumor marker protein selected from the group consisting of CK20, EGF-R, DEA, GA733.2, PDGF-β and stanniocalcin, whereby detection of at least one of the mRNAs indicates the presence of intestinal tumor cells in the blood sample.
2 . The procedure according to claim 1 , which further comprises detecting the presence or absence of at least one mRNA that codes for a tumor marker protein selected from the group consisting of GA733.2, PDF-β, EGF-R and CEA.
3 . The procedure according to claim 1 , wherein tumor cells from the blood sample are separated or enriched, and the detection is carried out with the tumor cells.
4 . The procedure according to claim 3 , wherein the intestinal tumor cells are separated or enriched by means of antibodies generally specific for tumor cells, by means of antibodies specific for intestinal tumor cells, or mixtures of such antibodies.
5 . The procedure according to claim 4 , wherein the antibodies used for the separation of intestinal tumor cells have binding sites that bind to epitopes of an epithelial antigen and/or an epithelial membrane antigen.
6 . The procedure according to claim 5 , wherein the antibody is MOC-31, Ber-EP4, or a mixture thereof.
7 . The procedure according to claim 1 , wherein the intestinal tumor cells are separated or enriched by means of antibodies bound to magnetic particles.
8 . The procedure according to claim 4 , wherein the intestinal tumor cells are separated or enriched by means of fluorescence-associated flow cytometry, density gradient centrifugation, and/or centrifugation after erythrocyte lysis.
9 . The procedure according to claim 8 , wherein a centrifugation of blood samples is performed to pelletize the leukocytes contained in the blood.
10 . The procedure according to claim 8 , wherein the components of the sample that contain RNA are concentrated by means of lysing the erythrocytes contained in the sample and then pelletizing the leukocytes that are not lysed.
11 . The procedure according to claim 8 , wherein the components that contain RNA are concentrated by at least a density gradient centrifugation of the blood sample to separate and obtain the mononuclear blood cells contained in the sample.
12 . The procedure according to claim 11 , wherein the mononuclear blood cells obtained are labeled with fluorescence-labeled antibodies and separated and obtained from the sample by means of fluorescence-activated cell sorting (FACS).
13 . The procedure according to claim 12 , wherein the mononuclear cells of the fraction obtained are lysed and the mRNA is separated.
14 . The procedure according to claim 1 , wherein the RNA is isolated directly from the blood sample, and wherein the RNA is total RNA or mRNA.
15 . The procedure according to claim 14 , wherein following the isolation of the mRNA, a DNA digestion is performed.
16 . The procedure according to claim 1 , wherein the mRNA is reverse-transcribed into cDNA and the presence or absence of cDNA that codes for the tumor marker protein is detected.
17 . The procedure according to claim 16 , wherein at least one predefined segment of the cDNA is replicated by a polymerase chain reaction (“PCR”).
18 . The procedure according to claim 17 , wherein one or more oligonucleotide pairs that have the following sequences are used for replicating the cDNA:
AACCCATGAGGCGGAGCAGAATGA
and
CGTTGGCGATGCATTTTAAGCTCT,
AGTCGGGCTCTGGAGGAAAAGAAA
and
GATCATAATTCCTCTGCACATAGG,
ATCTCCAAGGCCTGAATAAGGTCT
and
CCTCAGTTCCTTTTAATTCTTCAGT,
AGAAATGACGCAAGAGCCTATGTA
and
AACTTGTGTGTGTTGCTGCGGTAT,
AATCGTCAATGCCAGTGTACTTCA
and
TAACGCGTTGTGATCTCCTTCTGA,
and/or
TCTCTCTGCTGOTACCTGCGTCTG
and
GTTGGCGTTGGTGCGGTCTATGAG.
19 . The procedure according to claim 1 , wherein the procedure further comprises detecting the mRNA that codes for of the protein β-actin as an internal control.
20 . The procedure according to claim 19 , wherein the mRNA that codes for β-actin is reverse-transcribed into cDNA and a segment of the cDNA is replicated by means of a polymerase chain reaction.
21 . The procedure according to claim 20 , wherein an oligonucleotide pair is used for replicating the cDNA that codes for β-actin,
whereby the oligonucleotides of the pair have the following sequences:
CTGGAGAAGAGCTACGAGCTGCCT
and
ACAGGACTCCATGCCCAGGAAGGA.
22 . The procedure according to claim 17 , wherein the replicated cDNA segment is digested using restriction enzymes, and the presence or absence of the mRNA that codes for a tumor marker protein is determined by means of the cDNA fragments produced.
23 . The procedure according to claim 17 , wherein a gel electrophoresis of the PCR products is performed to detect the amplified cDNA segments.
24 . The procedure according to claim 17 , wherein a fragment analysis is performed to detect the amplified cDNA segments.
25 . The procedure according to claim 17 , wherein during the course of the polymerase chain reaction, the fluorescence of the products generated is detected and the product development is detected.
26 . The procedure according to claim 17 , wherein the mRNA or cDNA is detected using a nucleotide microarray.
27 . The procedure according to claim 26 , wherein the PCR product is applied to a nucleotide microarray to detect the amplified cDNA.
28 . A diagnostic kit for the diagnosis or monitoring of intestinal cancer, which kit comprises at least two pairs of oligonucleotides, whereby the two oligonucleotides of each pair are primers for amplification by means of a polymerase chain reaction of each of the two complementary strands of a desired DNA segment, and whereby the DNA segment amplified by each of the primer pairs comprises a portion of the cDNA that codes for a tumor marker protein selected from the group consisting of CK20, EGF-R, DEA, GA733.2, PDGF-β and stanniocalcin.
29 . The diagnostic kit according to claim 28 , wherein the kit contains at least three pairs of oligonucleotides, whereby the two oligonucleotides of each pair are primers for amplification by means of a polymerase chain reaction of each of the two complementary stands of a DNA segment, and
whereby each DNA segment comprises a portion of the cDNA that codes for a tumor marker protein selected from the group consisting of CK20, EGF-R, DEA, GA733.2, PDGF-β and stanniocalcin.
30 . The diagnostic kit according to claim 28 , wherein the kit contains an additional pair of oligonucleotides, which are primers for amplification of at least one segment of one of the two complementary strands of the cDNA that codes for the protein β-actin.
31 . The diagnostic kit according to claim 28 , wherein the two oligonucleotides of a pair have the following sequences, in a pair-wise manner:
AACCCATGAGGCGGAGCAGAATGA
and
CGTTGGCGATGCATTTTAAGCTCT,
AGTCGGGCTCTGGAGGAAAAGAAA
and
GATCATAATTCCTCTGCACATAGG,
ATCTCCAAGGCCTGAATAAGGTCT
and
CCTCAGTTCCTTTTAATTCTTCAGT,
AGAAATGACGCAAGAGCCTATGTA
and
AACTTGTGTGTGTTGCTGCGGTAT,
AATCGTCAATGCCAGTGTACTTCA
and
TAACGCGTTGTGATCTCCTTCTGA,
and/or
TCTCTCTGCTGOTACCTGCGTCTG
and
GTTGGCGTTGGTGCGGTCTATGAG.
32 . The diagnostic kit according to claim 31 , wherein at least one of the two oligonucleotides of a pair of oligonucleotides is labeled with fluorophores.
33 . The diagnostic kit according to claim 32 , wherein the oligonucleotides of different pairs are labeled with different fluorophores.
34 . The diagnostic kit according to claim 30 , wherein the kit contains a pair of oligonucleotides for amplification of the cDNA that codes for β-actin having with the following sequences:
CTGGAGAAGAGCTACGAGCTGCCT
and
ACAGGACTCCATGCCCAGGAAGGA.
35 . The diagnostic kit according to claim 34 , wherein at least one of the two oligonucleotides of the pair for amplification of the cDNA that codes for β-actin is labeled with fluorophores.
36 . The diagnostic kit according to claim 28 , wherein the kit contains the substances required for performing a polymerase chain reaction.
37 . The diagnostic kit according to claim 36 , wherein the kit contains a buffer solution, magnesium chloride, deoxynucleotide triphosphate and a heat-stable polymerase.
38 . The diagnostic kit according to claim 37 , wherein the heat-stable polymerase is a Thermus aquaticus polymerase (Taq polymerase).
39 . The diagnostic kit according to claim 28 , wherein the kit contains, as a positive control, at least one DNA sample that codes for a tumor marker protein selected from the group consisting of CK20, EGF-R, DEA, GA733.2, PDGF-β, and stanniocalcin.
40 . The diagnostic kit according to claim 28 , wherein the kit contains instructions for performing the polymerase chain reaction and/or instructions for performing a fragment analysis.
41 . The diagnostic kit according to claim 28 , wherein the kit contains a chart for evaluating the measurement results obtained.
42 . The diagnostic kit according to claim 28 , wherein the kit contains a microarray, whereby the array has a number of cells separated from one another, and an oligonucleotide is arranged in at least one cell of the microarray, which oligonucleotide hybridizes with the DNA segment.
43 . The diagnostic kit according to claim 42 , wherein in at least one additional cell of the microarray, another oligonucleotide is arranged and the sequence of the oligonucleotide arranged in the at least one additional cell differs from the sequence of the other oligonucleotides.
44 . A microarray for diagnosis or monitoring of intestinal cancer, which comprises an arrangement of several cells separated from one another, wherein a different oligonucleotide is arranged in each cell, whereby each oligonucleotide hybridizes with a DNA segment that comprises a portion of the cDNA that codes for a tumor marker protein selected from the group consisting of EGF-R, CEA, and GA733.2.
45 . The microarray according to claim 44 , wherein one or more oligonucleotides are arranged in one or more additional cells, whereby each oligonucleotide hybridizes with a DNA segment that comprises a portion of the cDNA that codes for a tumor marker protein selected from the group consisting of CK20, PGDF-β and stanniocalcin.
46 .- 63 . (canceled)