SMAD7 inhibitors for the treatment of CNS diseases
View Patent ↗The present invention relates to the use of a specific inhibitor of Smad7 expression or function for the preparation of a pharmaceutical composition for the prevention, amelioration or treatment of a disease of the central nervous system and/or diseases related and/or caused by said disease of the central nervous system. Furthermore, methods for preventing, ameliorating and/or treating such diseases are disclosed.
1. A method for ameliorating and/or treating multiple sclerosis in a subject comprising administering to said subject a therapeutically effective amount of an anti-Smad7 antisense oligonucleotide molecule comprising the nucleic acid molecule gtcgccccttctccccgcag (SEQ ID NO. 20).
2. The method of claim 1 , wherein said subject is a mammal.
3. The method of claim 2 , wherein said mammal is a human.
4. The method of claim 1 , wherein said multiple sclerosis is selected from the group consisting of relapsing-remitting multiple sclerosis, secondary progressive multiple sclerosis, primary chronic progressive multiple sclerosis, neuromyelitis optica (Devic's syndrome), acute disseminated encephalomyelitis, fulminant multiple sclerosis (Marburg's variant), isolated autoimmune optic neuritis, isolated autoimmune transverse myelitis and flab's concentric sclerosis.