Diagnosis kit, dna chip, and methods for diagnosing or supervising the treatment of testicular cancer
The invention relates to a diagnosis kit, a DNA chip, and to methods for diagnosing or supervising the treatment of testicular cancer, which are of greatest importance, in particular, within the scope of cancer prevention and post-treatment. The invention is essentially characterized in that the mRNA of testicular tumor markers is detected in a blood sample, whereby the tumor markers depict a tumor-associated gene expression. To this end, particularly β-hCG, AFP, PLAP or GCAP come into question. The detection of the mRNA is carried out by reverse transcription in cDNA and by subsequently amplifying selected segments of the cDNA by means of polymerase chain reaction.
1 . A diagnostic kit for diagnosis or treatment control of testicular tumors with at least two pairs of oligonucleotides (reverse primer, forward primer),
whereby the two oligonucleotides for each pair are each suitable as primers for amplification by means of a polymerase chain reaction of one of the two complementary strands of different desired DNA segments, and
whereby the one desired DNA segment is part of the cDNA for one of the tumor-marker proteins, placenta-specific alkaline phosphatase (PLAP) or germ-cell-specific alkaline phosphatase (GCAP), and the other desired DNA segment is part of the cDNA for the tumor marker protein epithelial glycoprotein 40 (GA733.2 or EGP40):
2 . A diagnostic kit according to the claim 1 , characterized in that it contains at least three pairs of oligonucleotides (reverse primer, forward primer),
whereby the two oligonucleotides of each pair are suitable as primers for amplification by means of a polymerase chain reaction of the two complimentary strand of the desired DNA segment, and
whereby the desired DNA segments are each part of the cDNA for various tumor-marker proteins selected from the tumor-marker proteins placenta-specific alkaline phosphatase (PLAP), germ-cell-specific alkaline phosphatase (GCAP), epithelial glycoprotein 40 (GA733.2 or EGP40), high-mobility group protein isoform I-C (HMGI-C), and/or gastrin-releasing peptide receptor (GRPR).
3 . A diagnostic kit according to claim 1 , characterized in that it contains at least one additional pair of oligonucleotides (reverse primer, forward primer),
whereby the two oligonucleotides of the pair are suitable as primers for amplification by means of a polymerase chain reaction of the reaction product of a polymerase chain reaction with one of the other oligonucleotide pairs.
4 . A diagnostic kit according to claim 1 , characterized in that it contains another pair of oligonucleotides, each of which is suitable as a primer for amplification of at least one segment of one of the two complementary strands of the cDNA for the protein β-actin as an internal control.
5 . A diagnostic kit according to claim 1 , characterized in that the two oligonucleotides of a pair have the following sequences, pairwise:
GCCACGCAGCTCATCTCCAACATG
(SEQ ID NO: 1)
and
ATGATCGTCTCAGTCAGTGCCCGG;
(SEQ ID NO: 2)
and/or
AATCGTCAATGCCAGTGTACTTCA
(SEQ ID NO: 3)
and
TAACGCGTTGTGATCTCCTTCTGA;
(SEQ ID NO: 4)
and/or
AAAGGCAGCAAAAACAAGAGTCCC
(SEQ ID NO: 5)
and
CCAACTGCTGCTGAGGTAGAAATC;
(SEQ ID NO: 6)
and/or
TCTCCCCGTGAACGATGACTGGTC
(SEQ ID NO: 7)
and
TGAAGACAGACACCCCAACAGAGG.
(SEQ ID NO: 8)
6 . A diagnostic kit according to claim 4 , characterized in that at least one of each of the two oligonucleotides of a pair of oligonucleotides is labeled with fluorophores.
7 . A diagnostic kit according to claim 6 , characterized in that the oligonucleotides of different pairs are labeled with different fluorophores.
8 . A diagnostic kit according to claim 1 , characterized in that it contains a pair of oligonucleotides with the following sequences for amplification of the cDNA for β-actin:
CTGGAGAAGAGCTACGAGCTGCCT
(SEQ ID NO: 9)
and
ACAGGACTCCATGCCCAGGAAGGA.
(SEQ ID NO: 10)
9 . A diagnostic kit according to claim 8 , characterized in that at least one of the two oligonucleotides of the pair is labeled with fluorophores for amplification of the cDNA for β-actin.
10 . A diagnostic kit according to claim 9 , characterized in that the oligonucleotide with the following sequence:
CTGGAGAAGAGCTACGAGCTGCCT
(SEQ ID NO: 9)
is labeled with the fluorophore-4,7,2″,4′,5′,7′-hexachloro-6-carboxyfluorescein.
11 . A diagnostic kit according to claim 1 , characterized in that it contains the substances required for performing a polymerase chain reaction.
12 . A diagnostic kit according to claim 1 , characterized in that it contains a buffer solution, magnesium chloride, deoxynucleotide-triphosphate, and a heat-stable polymerase as substances required for performing a polymerase chain reaction.
13 . A diagnostic kit according to claim 12 , characterized in that it contains a polymerase from Thermus aquaticus (Taq polymerase) as a heat-stable polymerase.
14 . A diagnostic kit according to claim 1 , characterized in that it contains a DNA sample with the desired DNA segment as a positive control.
15 . A diagnostic kit according to claim 1 , characterized in that it contains an instruction for performing the polymerase chain reaction and/or an instruction for performing a fragment analysis.
16 . A diagnostic kit according to claim 1 , characterized in that it contains a chart for evaluating the measurement results obtained.
17 . A diagnostic kit according to claim 1 , characterized in that it contains a microarray (DNA chip), whereby the array has a number of cells (fields) separate from one another and an oligonucleotide is arranged in at least one cell of the microarray that is hybridized with the desired DNA segment.
18 . A diagnostic kit according to claim 17 , characterized in that another oligonucleotide is arranged in at least one additional cell and the sequence of the oligonucleotide that is arranged in at least one additional cell differs from the sequence of the additional oligonucleotide.
19 . A diagnostic kit according to claim 17 , characterized in that an oligonucleotide is arranged in each of at least two cells, whereby the oligonucleotide arranged in various cells is hybridized with the various desired DNA segments.
20 . A microarray for diagnosis or treatment control of testicular tumors with an arrangement of several cells, separated from one another, characterized in that an oligonucleotide is arranged in at least one cell that is hybridized with a DNA segment that is part of the cDNA for the tumor-marker proteins placenta-specific alkaline phosphatase (PLAP) or germ-cell-specific alkaline phosphatase (GCAP), and in at least one additional cell a nucleotide is arranged that is hybridized with a DNA section which is part of the cDNA for the tumor marker protein epithelial glycoprotein 40 (GA733.2 or EGP40).
21 . A microarray according to claim 20 , characterized in that various oligonucleotides are arranged in three to four cells that hybridize with each of three to four different DNA segments that are part of the cDNA of each of different tumor-marker proteins selected from placenta-specific alkaline phosphatase (PLAP), germ-cell-specific alkaline phosphatase (GCAP), epithelial glycoprotein 40 (GA733.2 or EGP40), high-mobility group protein isoform I-C (HMGI-C), and/or gastrin-releasing peptide receptor (GRPR).
22 . A process for diagnosis or treatment control of testicular tumors in a human, characterized in that, in a human blood sample, the presence or absence of mRNA is detected that codes for at least the tumor-marker protein placenta-specific alkaline phosphatase (PLAP) or germ-cell-specific alkaline phosphates (GCAP), and the presence or absence is detected of mRNA that codes for the tumor marker protein epithelial glycoprotein 40 (GA733.2 or EGP40), and a conclusion is made therefrom of the presence of tumor cells in the blood sample, and therefore of a possible metastasis.
23 . A process according to claim 22 , characterized in that the presence or absence of at least one additional mRNA that codes for one of the tumor-marker proteins high-mobility group protein isoform I-C (HMGI-C) and/or gastrin-releasing peptide receptor (GRPR).
24 . A process according claim 22 , characterized in that the m-RNA is isolated directly from the whole-blood sample in a traditional manner.
25 . A process according to claim 24 , characterized in that a DNA digestion is performed after the isolation of the mRNA.
26 . A process according claim 22 , characterized in that the components of the blood sample that contain RNA are concentrated first and then this fraction is studied.
27 . A process according the claim 26 , characterized in that for concentrating the components containing RNA, a centrifugation of the blood sample is performed to pellet the leukocytes contained in it.
28 . A process according to claim 26 , characterized in that to concentrate the components containing RNA a lysis of the leukocytes contained in it is performed and then the non-lysed leukocytes are pelleted as a fraction and obtained for further diagnosis.
29 . A process according to claim 26 , characterized in that to concentrate the components containing RNA, at least one density-gradient centrifugation of the blood sample is used to separate and obtain the mononuclear blood cells contained in the sample.
30 . A process according to claim 22 , characterized in that, for the separation of testicular-tumor cells, the cells are labeled with fluorescence-labeled antibodies against tumor cells or testicular-tumor cells and separated and obtained from the sample by means of fluorescence-associated cell sorting (FACS).
31 . A process according to claim 22 , characterized in that, for the separation of tumor cells or testicular-tumor cells, the cells are brought into contact with magnetic particles and immobilized with antibodies on their surface aimed against tumor cells or testicular-tumor cells and the magnetic particles are then separated.
32 . A process according to claim 29 , characterized in that the mononuclear cells in the fraction obtained are lysed and the mRNA is separated.
33 . A process according to claim 24 , characterized in that the mRNA obtained is reverse-transcribed into cDNA and then the presence or absence of cDNA assigned to the tumor-marker protein is detected.
34 . A process according to claim 33 , characterized in that at least one predetermined segment of the cDNA is copied by a polymerase chain reaction (“PCR”) or a nested polymerase chain reaction (“nested PCR”).
35 . A process according to claim 34 , characterized in that, to copy the cDNA, one or more oligonucleotide pairs are used that have the following sequences:
GCCACGCAGCTCATCTCCAACATG
(SEQ ID NO: 1)
and
ATGATCGTCTCAGTCAGTGCCCGG;
(SEQ ID NO: 2)
and/or
AATCGTCAATGCCAGTGTACTTCA
(SEQ ID NO: 3)
and
TAACGCGTTGTGATCTCCTTCTGA;
(SEQ ID NO: 4)
and/or
AAAGGCAGCAAAAACAAGAGTCCC
(SEQ ID NO: 5)
and
CCAACTGCTGCTGAGGTAGAAATC;
(SEQ ID NO: 6)
and/or
TCTCCCCGTGAACGATGACTGGTC
(SEQ ID NO: 7)
and
TGAAGACAGACACCCCAACAGAGG.
(SEQ ID NO: 8)
36 . A process according to claim 22 , characterized in that the mRNA of the protein β-actin is detected as an internal control.
37 . A process according to claim 36 , characterized in that the mRNA for β-actin is reverse-transcribed into cDNA and a segment of the cDNA is copied by means of a polymerase chain reaction.
38 . A process according to claim 37 , characterized in that, to copy the cDNA of β-actin, an oligonucleotide pair is used, whereby the oligonucleotides of the pair have the following sequences:
CTGGAGAAGAGCTACGAGCTGCCT
(SEQ ID NO: 9)
and
ACAGGACTCCATGCCCAGGAAGGA.
(SEQ ID NO: 10)
39 . A process according to claim 38 , characterized in that the oligonucleotide with the sequence
CTGGAGAAGAGCTACGAGCTGCCT
(SEQ ID NO: 9)
is labeled with the fluorophore 4,7,2′,4′,5′,7′-hexachloro-6-carboxyfluorescein.
40 . A process according to claim 34 , characterized in that the copied cDNA segment is digested by suitable restriction enzymes and the presence or absence of the mRNA of a tumor-marker protein is determined on the basis of the cDNA fragments generated.
41 . A process according to claim 34 , characterized in that a gel electrophoresis of the PCR products is performed to detect the amplified cDNA segments.
42 . A process according to claim 34 , characterized in that a fragment analysis is performed to detect the amplified cDNA segments.
43 . A process according to claim 34 , characterized in that during the course of polymerase chain reaction the fluorescence generated by the products is detected and development of the product is detected (fluorescence-based real-time PCR).
44 . A process according to claim 24 , characterized in that a nucleotide microarray a microarray for diagnosis or treatment control of testicular tumors with an arrangement of several cells, separated from one another, characterized in that an oligonucleotide is arranged in at least one cell that is hybridized with a DNA segment that is part of the cDNA for the tumor-marker proteins placenta-specific alkaline phosphatase (PLAP) or germ-cell-specific alkaline phosphatase (GCAP), and in at least one additional cell a nucleotide is arranged that is hybridized with a DNA section which is part of the cDNA for the tumor marker protein epithelial glycoprotein 40 (GA733.2 or EGP40) is used to detect the mRNA or cDNA.
45 . A process according to claim 44 , characterized in that the PCR product is applied to a nucleotide microarray a microarray for diagnosis or treatment control of testicular tumors with an arrangement of several cells, separated from one another, characterized in that an oligonucleotide is arranged in at least one cell that is hybridized with a DNA segment that is part of the cDNA for the tumor-marker proteins placenta-specific alkaline phosphatase (PLAP) or germ-cell-specific alkaline phosphatase (GCAP), and in at least one additional cell a nucleotide is arranged that is hybridized with a DNA section which is part of the cDNA for the tumor marker protein epithelial glycoprotein 40 (GA733.2 or EGP40)to detect the amplified cDNA.
46 . A method for diagnosis of diseases or metastasis or for treatment control of a testicular tumor comprising the diagnostic kit of claim 1.