Immunostimulatory nucleic acid molecules
View Patent ↗Nucleic acid sequences containing unmethylated CpG dinucleotides that modulate an immune response including stimulating a Th1 pattern of immune activation, cytokine production, NK lytic activity, and B cell proliferation are disclosed. The sequences are also useful a synthetic adjuvant.
1. An immunostimulatory nucleic acid, having a sequence including at least the following formula:
5′ TCGTCGTTTTGTCGTTTTGTCGTT 3′ (SEQ ID No. 46)
wherein the nucleic acid has less than or equal to 100 nucleotides, and wherein C is unmethylated.
2. The immunostimulatory nucleic acid of claim 1 , wherein at least one nucleotide has a phosphate backbone modification and wherein the phosphate backbone modification is a phosphorothioate or phosphorodithioate modification.
3. The immunostimulatory nucleic acid of claim 1 , wherein at least one nucleotide has a phosphate backbone modification and wherein the phosphate backbone modification occurs at the 5′ end of the nucleic acid.
4. The irnmunostimulatory nucleic acid of claim 1 , wherein at least one nucleotide has a phosphate backbone modification and wherein the phosphate backbone modification occurs at the 3′ end of the nucleic acid.
5. The immunostimulatory nucleic acid of claim 1 , wherein the immunostimulatory nucleic acid is less than 40 nucleotides in length.
6. The immunostimulatory nucleic acid of claim 1 , wherein the immunostimulatory nucleic acid has a sequence consisting of
TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID No. 46).
7. The immunostimulatory nucleic acid of claim 6 , wherein each intemucleotide linkage has a phosphorothioate modification.
8. An immunostimulatory composition comprising the immunostimulatory nucleic acid of claim 6 , and an antigen.
9. The immunostimulatory composition of claim 8 , wherein the antigen is a vaccine and further comprising a conventional adjuvant.
10. The immunostimulatory nucleic acid of claim 1 , wherein the immunostimulatory nucleic acid is formulated as a composition with a pharmaceutically acceptable carrier.