Assay for species sources
A family of PCR assays is disclosed for determining, both qualitatively and quantitatively, presence of material from a predetermined species source and for quantifying the amount of such material. The assays are based respectively on SINEs uniquely characteristic of pig species, cow species, chicken species, and ruminant sub-order, and having a high copy number. The assays disclosed permit rapid, inexpensive evaluation of meat samples to facilitate elimination from their diet of pork or beef by persons desiring to avoid such food sources; as well as the assay of cattle feed to determine presence therein of ruminant-source proteins, which are a potential source of bovine spongiform encephalopathy (BSE), commonly referred to as “mad cow disease.” The assays amplify the predetermined unique SINEs and the resulting amplified mixture is then evaluated qualitatively by electrophoresis on gel containing ethidium bromide or quantitatively by SYBR Green-based detection or TaqMan chemistry. The invention also extends to kits, primers, and other products used in connection with the assays. The amplicons are selected to be from about 100 to 170 bp long.
1. A process for assaying a sample of unknown content to determine the presence of bovine-source material in the sample, said process comprising the steps of:
(1) extracting a DNA sample from the sample to be assayed;
(2) adding to the DNA sample a primer pair, said primer pair comprising:
the sequence of 5′ TTTCTTGTTATAGCCCACCACAC 3′ (SEQ ID NO: 1); and
the sequence of 5′ TTTCTCTAAAGGTGGTTGGTCAG 3′ (SEQ ID NO: 2), whereby a pre-PCR mixture is provided;
(3) carrying out a polymerase chain reaction (PCR) on the pre-PCR mixture, whereby an amplified DNA product results; and
(4) determining the presence in the amplified DNA product of a predetermined amplicon representative of 1.711B bovine repeat.
2. The process of claim 1 , wherein the step of determining the presence of the predetermined amplicon comprises:
performing electrophoresis.
3. The process of claim 1 , wherein the step of determining the presence of the predetermined amplicon comprises:
adding SYBR Green dye in the step of carrying out the polymerase chain reaction;
subjecting the amplified DNA product to UV to provide a fluorescent signal; and
then evaluating the fluorescent signal for a PCR cycle at which it crosses a baseline.
4. A process for assaying a sample of unknown content to determine the presence of chicken-source material in the sample, said process comprising the steps of:
(1) extracting a DNA sample from the sample to be assayed;
(2) adding to the DNA sample a primer pair, said primer pair comprising:
the sequence of 5′ CTGGGTTGAAAAGGACCACAGT 3′ (SEQ ID NO: 5); and
the sequence of 5′ GTGACGCACTGAACAGGTTG 3′ (SEQ ID NO: 6), whereby a pre-PCR mixture is provided;
(3) carrying out a polymerase chain reaction (PCR) on the pre-PCR mixture, whereby an amplified DNA product results; and
(4) determining the presence in the amplified DNA product of a predetermined amplicon representative of CR 1 repeat.
5. The process of claim 4 , wherein the step of determining the presence of the predetermined amplicon comprises:
performing electrophoresis.
6. The process of claim 4 , wherein the step of determining the presence of the predetermined amplicon comprises:
adding SYBR Green dye in the PCR amplification step;
subjecting the amplified product to UV to provide a fluorescent signal; and
then evaluating the fluorescent signal for a PCR cycle at which it crosses a baseline.