Nucleic acid melting analysis with saturation dyes
View Patent ↗Methods are provided for nucleic acid analysis wherein a target nucleic acid is mixed with a dsDNA binding dye to form a mixture. Optionally, an unlabeled probe is included in the mixture. A melting curve is generated for the target nucleic acid by measuring fluorescence from the dsDNA binding dye as the mixture is heated. Dyes for use in nucleic acid analysis and methods for making dyes are also provided.
1. A PCR reaction mixture comprising
a. a target nucleic acid,
b. PCR reagents,
c. a pair of oligonucleotide primers configured for amplifying a portion of the target nucleic acid to produce an amplicon, and
d. a dsDNA binding dye having the formula:
wherein
the moiety Y represents an optionally-substituted fused monocyclic or polycyclic aromatic ring or an optionally-substituted fused monocyclic or polycyclic nitrogen-containing heteroaromatic ring;
X is oxygen, sulfur, selenium, tellurium or a moiety selected from C(CH 3 ) 2 and NR 1 , where R 1 is hydrogen or C 1-6 alkyl;
R 2 is selected from the group consisting of C 1-6 alkyl, C 3-8 cycloalkyl, aryl, aryl(C 1-3 alkyl), hydroxyalkyl, alkoxyalkyl, aminoalkyl, mono and dialkylaminoalkyl, trialkylammoniumalkyl, alkylenecarboxylate, alkylenecarboxamide, alkylenesulfonate, optionally substituted cyclic heteroatom-containing moieties, and optionally substituted acyclic heteroatom-containing moieties;
t=0 or 1;
Z is a charge selected from 0 or 1;
R 3 , R 9 , and R 10 are each independently selected from the group consisting of hydrogen, C 1-6 alkyl, and arylcarbonyl;
n=0,1, or 2; and
Q is an heterocycle selected from the group of structures consisting of:
wherein R 5 , R 6 , R 7 , and R 8 are independently selected from the group consisting of hydrogen, halogen, alkyl, cycloalkyl, heteroalkyl, heterocycloalkyl, alkenyl, polyalkenyl, alkynyl, polyalkynyl, alkenylalkynyl, aryl, heteroaryl, alkoxy, alkylthio, arylthio, arylcarbonylthio, dialkylamino, cycloheteroalkylcarbonylthio, dialkylaminoalkylcarbonylthio, cycloalkylthio, cycloheteroalkylthio, trialkylanimoniumalkylthio, and nucleosidylthio, each of which may be optionally substituted; an acyclic heteroatom-containing moiety or a cyclic heteroatom-containing moiety, a BRIDGE-DYE, and a reactive group, each of which optionally includes a guaternary ammonium moiety, and
R 4 is selected from the group consisting of arylcarbonylthio, cycloheteroalkylcarbonylthio, dialkylaminoalkylcarbonylthio, cycloalkylthio, cycloheteroalkylthio, trialkylammoniumalkylthio, and nucleosidylthio, each of which may be optionally substituted,
wherein the dye is selected from the group consisting of F7, N7, O7, P7, Q7, R7, S7, T7, V7, W7, X7, T8, A9, C9, I9, J9, K9, L9, M9, N9, O9, P9 and R9 as presented in Table 2.
2. The PCR reaction mixture of claim 1 , wherein the dsDNA binding dye has a percent saturation of at least 50%.
3. The PCR reaction mixture of claim 1 , further comprising an unlabeled probe configured to hybridize to at least part of the amplicon.
4. The PCR reaction mixture of claim 1 , further comprising a second pair of oligonucleotide primers configured for amplifying a second portion of the target nucleic acid to produce a second amplicon.
5. A kit for analyzing a target nucleic acid comprising:
an unlabeled probe, the unlabeled probe blocked at its 3′-end and configured to hybridize at least partially to the target nucleic acid, and
a dsDNA binding dye having a percent saturation of at least 50%, wherein the dye is selected from the group consisting of N7, R7, X7, T8, O7, P8, P7, Q7, T7, V7, W8, Z8, Z7, X8, G9, C9, A9, M9, N9, I9, J9, K9, L9, O9, and P9 as presented in Table 2.
6. The kit of claim 5 , further comprising
a thermostable polymerase, and
oligonucleotide primers configured for amplifying the target nucleic acid.
7. The kit of claim 5 , wherein the oligonucleotide primers comprise a first primer and a second primer, wherein the first primer is provided in a molar amount greater than the second primer.
8. A kit for analyzing a target nucleic acid comprising:
an unlabeled probe configured to hybridize at least partially to the target nucleic acid, and
a dsDNA binding dye selected from the group consisting of N7, R7, X7, T8, O7, P8, P7, Q7, T7, V7, W8, Z8, Z7, X8, G9, C9, A9, M9, N9, I9, J9, K9, L9, O9, and P9 as presented in Table 2.
9. A kit for analyzing a target nucleic acid sequence, the kit comprising:
i. a pair of primers configured for amplifying the target nucleic acid sequence, wherein the target nucleic acid sequence is a locus of a c-kit gene, wherein the pair of primers is CTCTCCAGAGTGCTCTAATGAC (SEQ ID NO. 42) and AGCCCCTGTTTCATACTGACC (SEQ ID NO. 43),
ii, a thermostable polymerase, and
iii, a dsDNA binding dye having a percent saturation of at least 50%.