IP Library Granted Patent US 8,188,254
Granted Patent B2
US 8,188,254 · App. 10/978,283 · Granted May 29, 2012

C-class oligonucleotide analogs with enhanced immunostimulatory potency

View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 8,188,254
App. No.
10/978,283
Granted
May 29, 2012
Kind
B2
Abstract

The invention relates to a class of CpG immunostimulatory oligonucleotides containing a CpG immunostimulatory motif and a second motif which is capable of forming secondary structure, including duplex and higher order structures, in vitro and in vivo. The oligonucleotides of the invention are useful as adjuvants in vaccination. The oligonucleotides are also useful for inducing an immune response, inducing expression of a type I interferon (IFN), inducing expression of gamma interferon (IFN-γ), and for treating a variety of conditions, including allergy, asthma, infection, and cancer.

Claims (286)

1. An immunostimulatory nucleic acid molecule of Formula I

Z 1 [(X 1 Y 1 R 1 ) N (X 2 Y 2 R 2 ) k Z 2 ] p (S 1 ) q N′ (N n ) . . . (N 2 )(N 1 ) S 2 (N 1# )(N 2# ) . . . (N n# ) Z 3   (Formula I)

wherein

each of Z 1 , Z 2 , and Z 3 is independently any sequence 0 to 12 nucleotides long and wherein Z 3 is fewer than 3 nucletides

each of X 1 and X 2 is independently a nucleotide containing thymine, uracil, adenine, or a 5-substituted uracil;

each of Y 1 and Y 2 is independently a cytosine (C) or a modified cytosine;

each of R 1 and R 2 is independently a guanine (G) or a modified guanine;

each of N and N′ is independently any sequence 0 to 12 nucleotides long which optionally comprises a non-nucleotidic linker or abasic dSpacer;

S 1 is a non-nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units, which optionally provides for 2′5′-, 5′5′-, 3′3′-, 2′2′-, or 2′3′-internucleoside linkages;

S 2 is any non-palindromic sequence 1 to 10 nucleotides long or a non-nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units;

each of N n , . . . N 2 , N 1 , and N 1# , N 2# , . . . N n# is any nucleotide or modified nucleotide wherein N 1 base-pairs with N 1# , N 2 base-pairs with N 2# , . . . and N n base-pairs with N n# ; such that (N n ) . . . (N 2 )(N 1 ) S 2 (N 1# )(N 2# ) . . . (N n# ) forms an inverted repeat capable of forming a hairpin stem-loop structure having a stem of at least 4 consecutive base pairs long,

k is an integer from 0 to 5;

n is an integer from 2 to 16;

p is an integer from 1 to 6; and

q is an integer from 0 to 10,

and wherein when (N n ) . . . (N 2 )(N 1 ) S 2 (N 1# )(N 2# ) . . . (N n# ) is 10 to 42 nucleotides long, S 2 is 6 to 10 nucleotides long or is a non-nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units, and/or (N n ) . . . (N 2 )(N 1 ) S 2 (N 1# )(N 2# ) . . . (N n# ) has a GC content that is less than ⅔′.

2. The immunostimulatory nucleic acid molecule of claim 1 , wherein each of N n , . . . N 2 , N 1 , and N 1# , N 2# , . . . N n# is chosen from C, G, or modifications thereof, and wherein C base-pairs with G.

3. The immunostimulatory nucleic acid molecule of claim 1 , wherein each of N n , . . . N 2 , N 1 , and N 1# , N 2# , . . . N n# is chosen from T, A, or modifications thereof, and wherein T base-pairs with A.

4. The immunostimulatory nucleic acid molecule of claim 1 , wherein each of N n , . . . N 2 , N 1 , and N 1# , N 2# , . . . N n# is chosen from C, T, A, G, or modifications thereof.

5. The immunostimulatory nucleic acid molecule of claim 1 , wherein each of N n , . . . N 2 , N 1 , and N 1# , N 2# , . . . N n# is chosen from unmodified or modified nucleotides which form Watson-Crick base pairs.

6. The immunostimulatory nucleic acid molecule of claim 1 , wherein at least one of each of N n , . . . N 2 , N 1 , and N 1# , N 2# , . . . N n# is chosen from unmodified or modified nucleotides which form non-Watson-Crick base pairs.

7. The immunostimulatory nucleic acid molecule of claim 1 , wherein each of Y 1 R 1 and Y 2 R 2 have an internucleotide linkage that is a phosphodiester bond.

8. The immunostimulatory nucleic acid molecule of claim 7 , wherein all other internucleotide linkages of the nucleic acid are stabilized internucleotide linkages.

9. The immunostimulatory nucleic acid molecule of claim 1 , wherein internucleotide linkages of the oligonucleotide are all phosphorothioate linkages.

10. The immunostimulatory nucleic acid molecule of claim 1 , wherein Y 1 is C.

11. The immunostimulatory nucleic acid molecule of claim 1 , wherein R 1 is G.

12. The immunostimulatory nucleic acid molecule of claim 1 , wherein Y 1 is C and R 1 is G.

13. The immunostimulatory nucleic acid molecule of claim 1 wherein X 1 or X 2 is T.

14. The immunostimulatory nucleic acid molecule of claim 1 , wherein X 1 is T, X 2 is T, Y 1 is C, R 1 is G, and k is 1.

15. The immunostimulatory nucleic acid molecule of claim 1 , wherein X 1 is T, X 2 is T, Y 1 is C, R 1 is G, k is 1, p is 1, N and N′ and Z 3 each contain zero nucleotides, and Z 2 is TTTT or d(UUUU).

16. The immunostimulatory nucleic acid molecule of claim 1 , wherein S 2 is a non-nucleotidic linker.

17. The immunostimulatory nucleic acid molecule of claim 1 , wherein S 2 contains at least one abasic dSpacer residue.

18. The immunostimulatory nucleic acid molecule of claim 1 , wherein S 1 is a doubler unit or a trebler unit.

19. The immunostimulatory nucleic acid molecule of claim 1 , wherein the oligonucleotide comprises at least one 2′5′-, 5′5′-, 3′3′-, 2′2′-, or 2′3′-internucleoside linkage.

20. An immunostimulatory nucleic acid molecule of Formula III

(Z′) m Z 3   (Formula III)

wherein Z′ is Z 1 [(X 1 Y 1 R 1 ) N (X 2 Y 2 R 2 ) k Z 2 ] p (S 1 ) q N′ (N n ) . . . (N 3 )(N 2 )(N 1 ) S 2 (N 1# )(N 2# )(N 3# ) . . . (N n# );

each of Z 1 , Z 2 , and Z 3 is independently any sequence 0 to 12 nucleotides long which optionally comprises a non-nucleotidic linker or abasic dSpacer;

each of X 1 and X 2 is independently a nucleotide containing thymine, uracil, adenine, or a 5-substituted uracil;

each of Y 1 and Y 2 is independently a cytosine or a modified cytosine;

each of R 1 and R 2 is independently a guanine or a modified guanine;

each of N and N′ is independently any sequence 0 to 12 nucleotides long which optionally comprises a non-nucleotidic linker or abasic dSpacer;

S 1 is a non-nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units, which optionally provides for 2′5′-, 5′5′-, 3′3′-, 2′2′-, or 2′3′-internucleoside linkages;

S 2 is any non-palindromic sequence 1 to 10 nucleotides long or a non-nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units;

wherein the linkage of Z′ to Z′ is defined by S 3 and S 3 is a direct or indirect 2′5′-, 5′5′-, 3′3′-, 2′2′-, or 2′3′-internucleoside linkage, or a non-nucleotidic linker, said non-nucleotidic linker comprising abasic linkers (dSpacers), triethylene glycol units, or hexaethylene glycol units facilitating a 2′5′-, 5′5′-, 3′3′-, 2′2′-, or 2′3′- linkage of m sequence parts;

each of N n , . . . N 3 , N 2 , N 1 , and N 1# , N 2# , N 3# . . . N n# is any nucleotide or modified nucleotide wherein N 1 base-pairs with N 1# , N 2 base-pairs with N 2 #, N 3 base-pairs with N 3# , . . . and N n base-pairs with N n# ;

k is an integer from 0 to 5;

m is an integer from 2 to 10;

n is an integer from 2 to 16;

p is an integer from 1 to 6; and

q is an integer from 0 to 10.

21. An immunostimulatory nucleic acid molecule of claim 1 , wherein Z 1 [(X 1 Y 1 R 1 ) N (X 2 Y 2 R 2 ) k Z 2 ] p (S 1 ) q is a non-palindromic sequence.

22. An immunostimulatory nucleic acid molecule of claim 1 , wherein Z 1 [(X 1 Y 1 R 1 ) N (X 2 Y 2 R 2 ) k Z 2 ] p (S 1 ) q is TCGTCGTTTT (SEQ ID NO:40), TCGTCGTTLL, TCGA, TCGAC, TCGACGTC, or TCGACGTCG, wherein L is dSpacer.

23. An immunostimulatory nucleic acid molecule of claim 1 , wherein Z 1 [(X 1 Y 1 R 1 ) N (X 2 Y 2 R 2 ) k Z 2 ] p (S 1 ) q is a palindromic sequence.

24. The immunostimulatory nucleic acid molecule of claim 1 , wherein Z 1 [(X 1 Y 1 R 1 ) N (X 2 Y 2 R 2 ) k Z 2 ] p (S 1 ) q is TCGACGTCGA (SEQ ID NO:19) or TCGTCGACGA (SEQ ID NO:34).

25. The immunostimulatory nucleic acid molecule of claim 1 , wherein Z 1 [(X 1 Y 1 R 1 ) N (X 2 Y 2 R 2 ) k Z 2 ] p (S 1 ) q is TCGCGACGTT (SEQ ID NO:26) or TCGCGTCGTT (SEQ ID NO:69).

26. The immunostimulatory nucleic acid molecule of claim 1 , wherein (N n ). . .(N 2 )(N 1 ) S 2 (N 1# )(N 2# ). . .(N n ) Z 3 comprises a sequence

AGCGAAGCT,

CAATATTTATTG,

(SEQ ID NO: 1)

CCGTTTTGTGG,

(SEQ ID NO: 2)

CGGCGCCGTGCCG,

(SEQ ID NO: 19)

CGGCGCCGTTGCCG,

(SEQ ID NO: 34)

CGGCGLLCGCCG,

(SEQ ID NO: 5)

CGGCGLLLTGCCG,

(SEQ ID NO: 6)

CGGCGGLLCCGCCG,

(SEQ ID NO: 7)

CGGCGTCGCCGCCG,

(SEQ ID NO: 8)

CGTCGACGGGACGGG,

(SEQ ID NO: 10)

CGTCGACGTGACGGG,

(SEQ ID NO: 11)

GAGAGTTGGGCTCTC,

(SEQ ID NO: 12)

GTCGAGGAGGT,

(SEQ ID NO: 14)

TAATALLTATTA,

(SEQ ID NO: 15)

TAATATCCATTA,

(SEQ ID NO: 16)

or

TAATATTTATTA,

(SEQ ID NO: 17)

wherein L is dSpacer.

27. The immunostimulatory nucleic acid molecule of claim 1 , wherein (N n ). . .(N 2 )(N 1 ) S 2 (N 1# )(N 2# ). . .(N n# ) comprises a sequence GGCGCGCTGCCG (SEQ ID NO:13).

28. The immunostimulatory nucleic acid molecule of claim 1 , comprising a sequence

TCGACGTCGACCGTTTTGTGG,

(SEQ ID NO: 20)

TCGACGTCGACGGGACGGG,

(SEQ ID NO: 21)

TCGACGTCGACGTGACGGG,

(SEQ ID NO: 22)

TCGACGTCGAGAGTTGGGCTCTC,

(SEQ ID NO: 23)

TCGACGTCGAGCGAAGCT,

(SEQ ID NO: 24)

or

TCGACGTCGAGGAGGT

(SEQ ID NO: 25).

29. An immunostimulatory nucleic acid molecule of Formula I

Z 1 [(X 1 Y 1 R 1 ) N (X 2 Y 2 R 2 ) k Z 2 ] p (S 1 ) q N′ (N n ) . . . (N 2 )(N 1 ) S 2 (N 1# )(N 2# ) . . . (N n# ) Z 3   (Formula I)

wherein

each of Z 1 , Z 2 , and Z 3 is independently any sequence 0 to 12 nucleotides long which optionally comprises a non-nucleotidic linker or abasic dSpacer;

each of X 1 and X 2 is independently a nucleotide containing thymine, uracil, adenine, or a 5-substituted uracil;

each of Y 1 and Y 2 is independently a cytosine (C) or a modified cytosine;

each of R 1 and R 2 is independently a guanine (G) or a modified guanine;

each of N and N′ is independently any sequence 0 to 12 nucleotides long which optionally comprises a non-nucleotidic linker or abasic dSpacer;

S 1 is a non-nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units, which optionally provides for 2′5′-, 5′5′-, 3′3′-, 2′2′-, or 2′3′-internucleoside linkages;

S 2 is any non-palindromic sequence 1 to 10 nucleotides long or a non-nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units;

each of N n , N 2 , . . . N 1 , and N 1# , N 2# , . . . N n# is any nucleotide or modified nucleotide wherein N 1 base-pairs with N 1# , N 2 base-pairs with N 2# , . . . and N n base-pairs with N n# ;

k is an integer from 0 to 5;

n is an integer from 2 to 16;

p is an integer from 1 to 6; and

q is an integer from 0 to 10,

and wherein when (N n ) . . . (N 2 )(N 1 ) S 2 (N 1# )(N 2# ) . . . (N n# ) is 10 to 42 nucleotides long, S 2 is 4 to 10 nucleotides long, or is a non-nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units, wherein the immunostimulatory nuclecic acid molecule comprises a sequence:

TCGTCGTTLLACGGCGCCGTGCCG,

(SEQ ID NO: 37)

TCGTCGTTLLACGGCGLLLTGCCG,

(SEQ ID NO: 38)

TCGTCGTTLLCGGCGCGGCGCCG,

(SEQ ID NO: 39)

TCGTCGTTTTACGGCGCCGTTGCCG,

(SEQ ID NO: 44)

TCGTCGTTTTACGGCGLLLTGCCG,

(SEQ ID NO: 45)

TCGTCGTTTTACGGCGTTTTGCCG,

(SEQ ID NO: 49)

TCGTCGTTTTCAATATTTATTG,

(SEQ ID NO: 50)

TCGTCGTTTTCGGCGLLCGCCG,

(SEQ ID NO: 52)

TCGTCGTTTTCGGCGGLLCCGCCG,

(SEQ ID NO: 54)

TCGTCGTTTTCGGCGTCGCCGCCG,

(SEQ ID NO: 55)

TCGTCGTTTTTAATALLTATTA,

(SEQ ID NO: 57)

TCGTCGTTTTTAATATCCATTA,

(SEQ ID NO: 58)

or

TCGTCGTTTTTAATATTTATTA,

(SEQ ID NO: 59)

wherein L is dSpacer.

30. The immunostimulatory nucleic acid molecule of claim 1 , comprising a sequence TCGCGTCGTTCGGCGCGCTGCCG (SEQ ID NO:30).

31. The immunostimulatory nucleic acid molecule of claim 1 , comprising a sequence TCGCGACGTTCGGCGCGCTGCCG (SEQ ID NO:27).

32. An immunostimulatory nucleic acid molecule of Formula I

Z 1 [(X 1 Y 1 R 1 ) N (X 2 Y 2 R 2 ) k Z 2 ] p (S 1 ) q N′ (N n ) . . . (N 2 )(N 1 ) S 2 (N 1# )(N 2# ) . . . (N n# ) Z 3   (Formula I)

wherein

each of Z 1 , Z 2 , and Z 3 is independently any sequence 0 to 12 nucleotides long which optionally comprises a non-nucleotidic linker or abasic dSpacer;

each of X 1 and X 2 is independently a nucleotide containing thymine, uracil, adenine, or a 5-substituted uracil;

each of Y 1 and Y 2 is independently a cytosine (C) or a modified cytosine;

each of R 1 and R 2 is independently a guanine (G) or a modified guanine;

each of N and N′ is independently any sequence 0 to 12 nucleotides long which optionally comprises a non-nucleotidic linker or abasic dSpacer;

S 1 is a non-nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units, which optionally provides for 2′5′-, 5′5′-, 3′3′-, 2′2′-, or 2′3′-internucleoside linkages;

S 2 is any non-palindromic sequence 1 to 10 nucleotides long or a non-nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units;

each of N n , . . . N 2 , N 1 , and N 1# , N 2# , . . . N n# is any nucleotide or modified nucleotide wherein N 1 base-pairs with N 1# , N 2 base-pairs with N 2# , . . . and N n base-pairs with N n# ;

k is an integer from 0 to 5;

n is an integer from 2 to 16;

p is an integer from 1 to 6; and

q is an integer from 0 to 10,

and wherein when (N n ) . . . (N 2 )(N 1 ) S 2 (N 1# )(N 2# ) . . . (N n# ) is 10 to 42 nucleotides long, S 2 is 4 to 10 nucleotides long, or is a non-nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units, and/or (N n ) . . . (N 2 )(N 1 ) S 2 (N 1# )(N 2# ) . . . (N n# ) has a GC content that is less than ⅔, wherein the immunostimulatory nuclecic acid molecule comprises a sequence chosen from:

(SEQ ID NO: 42)

T*C*G*T*C*G*T*T*T*T*A*C*G*A*C*G*C*C*G*T*G*C*C*G,

(SEQ ID NO: 36)

T*C*G*T*C*G*C*T*T*T*G*C*G*A*C*G*C*C*G*T*G*C*C*G,

(SEQ ID NO: 35)

T*C*G*T*C*G*C*C*C*G*G*C*G*A*C*G*C*C*G*T*G*C*C*G,

(SEQ ID NO: 44)

T*C*G*T*C*G*T*T*T*T*A*C*G*G*C*G*C*C*G*T*T*G*C*C*G,

(SEQ ID NO: 37)

T*C*G*T*C*G*T*T*L*L*A*C*G*G*C*G*C*C*G*T*G*C*C*G,

(SEQ ID NO: 45)

T*C*G*T*C*G*T*T*T*T*A*C*G*G*C*G*L*L*L*T*G*C*C*G,

(SEQ ID NO: 38)

T*C*G*T*C*G*T*T*L*L*A*C*G*G*C*G*L*L*L*T*G*C*C*G,

(SEQ ID NO: 54)

T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*G*L*L*C*C*G*C*C*G,

(SEQ ID NO: 55)

T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*T*C*G*C*C*G*C*C*G,

(SEQ ID NO: 39)

T*C*G*T*C*G*T*T*L*L*C*G*G*C*G*C*G*G*C*G*C*C*G,

(SEQ ID NO: 52)

T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*L*L*C*G*C*C*G,

(SEQ ID NO: 59)

T*C*G*T*C*G*T*T*T*T*T*A*A*T*A*T*T*T*A*T*T*A,

(SEQ ID NO: 59)

T*C*G*T*C_G*T*T*T*T*T*A*A*T*A*T*T*T*A*T*T*A,

(SEQ ID NO: 50)

T*C*G*T*C_G*T*T*T*T*C*A*A*T*A*T*T*T*A*T*T*G,

(SEQ ID NO: 58)

T*C*G*T*C_G*T*T*T*T*T*A*A*T*A*T*C*C*A*T*T*A,

(SEQ ID NO: 57)

T*C*G*T*C*G*T*T*T*T*T*A*A*T*A*L*L*T*A*T*T*A,

(SEQ ID NO: 45)

T*C*G*T*C_G*T*T*T*T*A*C*G*G*C*G*L*L*L*T*G*C*C*G,

(SEQ ID NO: 38)

T*C*G*T*C_G*T*T*L*L*A*C*G*G*C*G*L*L*L*T*G*C*C*G,

and

(SEQ ID NO: 54)

T*C*G*T*C_G*T*T*T*T*C*G*G*C*G*G*L*L*C*C*G*C*C*G,

wherein L is dSpacer, * is phosphorothioate, and _ is phosphodiester.

33. The immunostimulatory nucleic acid molecule of claim 1 , comprising a sequence chosen from

(SEQ ID NO: 21)

T*C*G*A*C*G*T*C*G_A_C*G*G*G*A*C*G*G*G,

(SEQ ID NO: 22)

T*C*G*A*C*G*T*C*G_A_C*G*T*G*A*C*G*G*G,

(SEQ ID NO: 21)

T*C*G*A*C*G*T*C*G*A*C*G*G*G*A*C*G*G*G,

(SEQ ID NO: 25)

T*C*G*A*C*G*T*C*G*A*G*G*A*G*G*T,

(SEQ ID NO: 24)

T*C*G*A*C*G*T*C*G*A*G*C*G*A*A*G*C*T,

(SEQ ID NO: 20)

T*C*G*A*C*G*T*C*G*A*C*C*G*T*T*T*T*G*T*G*G,

and

(SEQ ID NO: 23)

T*C*G*A*C*G*T*C*G*A*G*A*G*T*T*G*G*G*C*T*C*T*C,

wherein * is phosphorothioate and _ is phosphodiester.

34. The immunostimulatory nucleic acid molecule of claim 1 , comprising a sequence chosen from

(SEQ ID NO: 62)

T*C*G*A*C*G*T*C*G*A*C*G*T*G*A*C*G*T*G,

(SEQ ID NO: 61)

T*C*G*A*C*G*T*C*G*A*C*G*T*G*A*C*G,

(SEQ ID NO: 65)

T*C_G*T*C_G*A*C_G*T*T*C_G*G*C*G*C*C_G*T*G*C*C*G,

(SEQ ID NO: 66)

T*C*G*T*C_G*T*A*C_G*G*C*G*C*C_G*T*G*C*C*G,

(SEQ ID NO: 67)

T*C*G*T*C_G*T*T*A*C_G*G*C*G*C*C_G*T*G*C*C*G,

(SEQ ID NO: 63)

T*C*G*A*C*G*T*C*G*A*C*G*T*G*A*C*G*T*T,

(SEQ ID NO: 64)

T*C*G*T*C_G*A*C_G*A*T*C_G*G*C*G*C*C_G*T*G*C*C*G,

(SEQ ID NO: 64)

T*C*G*T*C*G*A*C*G*A_T_C*G*G*C*G*C*C*G*T*G*C*C*G,

(SEQ ID NO: 63)

T*C*G*A*C_G*T*C*G*A*C_G*T*G*A*C*G*T*T,

(SEQ ID NO: 63)

T*C*G*A*C_G*T*C*G*A*C*G*T_G*A*C*G*T*T,

and

(SEQ ID NO: 68)

T*C*G*T*C_G*T*T*T*A*C_G*G*C*G*C*C_G*T*G*C*C*G*T,

wherein * is phosphorothioate and _ is phosphodiester.

35. The immunostimulatory nucleic acid molecule of claim 1 , comprising a sequence chosen from

(SEQ ID NO: 30)

T*C*G*C_G*T*C*G*T*T*C_G*G*C*G*C_G*C*T*G*C*C*G,

(SEQ ID NO: 30)

T*C*G_C*G*T*C*G*T*T*C_G*G*C*G*C_G*C*T*G*C*C*G,

and

(SEQ ID NO: 30)

T*C*G*C*G_T*C*G*T*T*C_G*G*C*G*C_G*C*T*G*C*C*G,

wherein * is phosphorothioate and _ is phosphodiester.

36. The immunostimulatory nucleic acid molecule of claim 1 , comprising a sequence T*C*G*C_G*A*C*G*T*T*C_G*G*C*G*C_G*C*T*G*C*C*G (SEQ ID NO:27), wherein * is phosphorothioate and _ is phosphodiester.

37. The immunostimulatory nucleic acid molecule of claim 1 , comprising a sequence chosen from

(SEQ ID NO: 48)

T*C_G*T*C*G*T*T*T*T*A*C*G*G*C*G*T*C*G*T*G*C*C*G,

(SEQ ID NO: 47)

T*C_G*T*C*G*T*T*T*T*A*C*G*G*C*G*T*C*G*C*G*C*C*G,

and

(SEQ ID NO: 46)

T*C_G*T*C*G*T*T*T*T*A*C*G*G*C*G*T*C*G*C*G,

wherein * is phosphorothioate and _ is phosphodiester.

38. The immunostimulatory nucleic acid molecule of claim 1 , comprising s a sequence T*C_G*T*C*G*T*T*T*T*A*C*G*G*C*G*T*C*G*T*G*C*C*G (SEQ ID NO:48), wherein * is phosphorothioate and _ is phosphodiester.

39. The immunostimulatory nucleic acid molecule of claim 1 , wherein at least one nucleotide in the oligonucleotide is a substituted or modified purine or pyrimidine.

40. The immunostimulatory nucleic acid molecule of claim 39 , wherein the substituted pyrimidine is a C5- or C6-substituted pyrimidine.

41. The immunostimulatory nucleic acid molecule of claim 39 , wherein the substituted purine is a C8- or C7-substituted purine.

42. The immunostimulatory nucleic acid molecule of claim 39 , wherein the substituted or modified purine or pyrimidine is selected from the group consisting of 5-substituted cytosines, 6-substituted cytosines, N4-substituted cytosines, 5-aza-cytosine, 2-mercapto-cytosine, isocytosine, pseudo-isocytosine, cytosine analogs with condensed ring systems, and uracil derivatives, thymine derivatives, 7-deazaguanine, 7-deaza-7-substituted guanine, 7-deaza-8-substituted guanine, 7-deaza-8-aza guanine, hypoxanthine, N2-substituted guanines, 5-amino-3-methyl-3H,6H-thiazolo[4,5-d]pyrimidine-2,7-dione, 2,6-diaminopurine, 2-aminopurine, purine, indole, substituted adenines, 8-substituted guanine, and 6-thioguanine.

43. The immunostimulatory nucleic acid molecule of claim 39 , wherein the substituted or modified purine or pyrimidine is selected from the group consisting of 5-methyl-cytosine, 5-fluoro-cytosine, 5-chloro-cytosine, 5-bromo-cytosine, 5-iodo-cytosine, 5-hydroxy-cytosine, 6-hydroxy-cytosine, 5-hydroxymethyl-cytosine, 5-difluoromethyl-cytosine, and unsubstituted or substituted 5-alkynyl-cytosine, N4-ethyl-cytosine, N,N′-propylene cytosine, phenoxazine, 5-fluoro-uracil, 5-bromo-uracil, 5-bromovinyl-uracil, 4-thio-uracil, 5-hydroxy-uracil, 5-propynyl-uracil, 2-thiothymine, 4-thiothymine, 6-substituted thymines, 7-deaza-7-(C2-C6)alkynylguanine, N2-methyl-guanine, N6-methyl-adenine, 8-oxo-adenine, 8-hydroxyguanine, and 8-bromoguanine.

44. The immunostimulatory nucleic acid molecule of claim 39 , wherein the substituted or modified purine or pyrimidine is selected from the group consisting of a universal base, an aromatic ring system, an aromatic ring system, and a hydrogen atom (dSpacer).

45. The immunostimulatory nucleic acid molecule of claim 39 , wherein the substituted or modified purine or pyrimidine is selected from the group consisting of 4-methyl-indole, 5-nitro-indole, 3-nitropyrrole, P-base, and K-base, benzimidazole, dichloro-benzimidazole, 1-methyl-1H-[1,2,4]triazole-3-carboxylic acid amide, fluorobenzene, and difluorobenzene.

46. The immunostimulatory nucleic acid molecule of claim 1 , wherein any of N, S, X, or Z is substituted by a residue selected from the group consisting of C6-C30 alkyl chain, bile acids, cholic acid, taurocholic acid, deoxycholate, cholesterol, oleyl litocholic acid, oleoyl cholenic acid, glycolipids, phospholipids, sphingolipids, isoprenoids, steroids, vitamins, vitamin E, saturated fatty acids, unsaturated fatty acids, fatty acid esters, triglycerides, pyrenes, porphyrins, Texaphyrine, adamantane, acridines, biotin, coumarin, fluorescein, rhodamine, Texas-Red, digoxygenin, dimethoxytrityl, t-butyldimethylsilyl, t-butyldiphenylsilyl, cyanine dyes, cyanine dye Cy3, cyanine dye Cy576, Hoechst 33258 dye, psoralen, and ibuprofen.

47. An immunostimulatory nucleic acid molecule comprising

(a) a 5′ end beginning with an immunostimulatory motif chosen from (TCG) n N and RDCGY 1 Y 2 N, wherein T is thymine, C is unmethylated cytosine, G is guanine, R is a purine, D is not C, each of Y 1 and Y 2 independently is a pyrimidine, n is an integer between 1 and 4, inclusive, and N is any sequence 0-12 bases long;

(b) a 3′ end terminating in an inverted repeat capable of forming a hairpin or stem-loop structure, said structure comprising

a GC-rich stem, wherein the GC rich stem includes 5 to 6 consecutive nucleotides selected from G and C and including both C and G nucleotides, and

at least one unmatched or mismatched base; and

(c) a partially stabilized backbone comprising at least one phosphodiester 5′-CpG-3′ linkage.

48. An immunostimulatory nucleic acid having a base sequence provided as TCGTCGTTTTACGGCGTCGTGCCG (SEQ ID NO:48).

49. A pharmaceutical composition comprising an immunostimulatory nucleic acid molecule of claim 1 and a pharmaceutically acceptable carrier.

50. An immunostimulatory nucleic acid having a base sequence provided as TCGTCGTTTTACGGCGTCGTGCCG (SEQ ID NO:43).

Assignments (3)
CONFIRMATION OF EXCLUSIVE PATENT LICENSE Recorded Dec 20, 2005
From: COLEY PHARMACEUTICAL GROUP, INC.; COLEY PHARMACEUTICAL GROUP, LTD.; COLEY PHARMACEUTICAL, GMBH
To: PFIZER INC.
Reel/Frame 017353/0372 →
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Dec 1, 2005
From: KRIEG, ARTHUR M.
To: COLEY PHARMACEUTICAL GROUP, INC.
Reel/Frame 017081/0834 →
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Dec 1, 2004
From: UHLMANN, EUGEN; VOLLMER, JORG; NOLL, BERNHARD O.
To: COLEY PHARMACEUTICAL GMBH
Reel/Frame 015417/0340 →