Chromosome-based platforms
View Patent ↗Artificial chromosomes, including ACes, that have been engineered to contain available sites for site-specific, recombination-directed integration of DNA of interest are provided. These artificial chromosomes permit tractable, efficient, rational engineering of the chromosome for a variety of applications.
1. A method of introducing heterologous nucleic acid into an artificial chromosome, comprising:
contacting an animal or plant artificial chromosome comprising one or a plurality of att site(s) with a nucleic acid molecule comprising an insect artificial chromosome (IAC) and comprising both the heterologous nucleic acid and an att recombination site, in the presence of a recombinase that promotes recombination between the sites in the chromosome and in the nucleic acid molecule, wherein:
the one or a plurality of att site(s) are heterologous to the chromosome;
the recombinase is lambda integrase and the att site is a substrate for lambda integrase; and
the one or a plurality of att site(s) directs site-directed integration in the presence of lambda integrase.
2. The method of claim 1 , wherein the nucleic acid molecule encodes a therapeutic protein, antisense nucleic acid, or comprises an artificial chromosome.
3. The method of claim 1 , wherein the nucleic acid molecule with a recombination site is a PCR product.
4. The method of claim 1 , wherein the recombinase is a protein and the recombination event occurs in vitro.
5. A method for introducing heterologous nucleic acid into a human mesenchymal cell, comprising:
(a) introducing into the human mesenchymal cell a platform-ACes, wherein the platform-ACes has a first recombination site;
(b) introducing into the resulting cell a vector comprising at least a second recombination site and the heterologous nucleic acid; and
(c) incubating the resulting mixture in the presence of at least one recombination protein under conditions whereby recombination between the first and second recombination sites is effected, thereby introducing the heterologous nucleic acid into the platform-ACes within the mesenchymal cells.
6. The method of claim 5 , wherein the at least one recombination protein is encoded by a bacteriophage selected from the group consisting of bacteriophage lambda integrase (Int), phi 80, P22, P2, 186, P4 and P1.
7. The method of claim 6 , wherein the at least one recombination protein is encoded by bacteriophage lambda integrase (Int), or a mutant of bacteriophage lambda integrase (Int).
8. The method of claim 5 , wherein the at least one recombination protein is selected from the group consisting of Int, IHF, Xis, Fis, Cre, γδ, Tn3 resolvase, Hin, Gin, Cin and Flp.
9. The method of claim 5 , wherein the recombination sites are selected from the group consisting of att and lox P sites.
10. The method of claim 5 , wherein the first and/or second recombination site contains at least one mutation in the sequence of nucleic acids encoding the recombination site that removes one or more stop codons introduced by virtue of the recombination site.
11. The method of claim 5 , wherein the first and/or second recombination site contains at least one mutation in the sequence of nucleic acids encoding the recombination site that avoids hairpin formation introduced by virtue of the recombination site.
12. The method of claim 5 , wherein the first and/or second recombination sites comprises at least a first nucleic acid sequence selected from among:
a)
RKYCWGCTTTYKTRTACNAASTSGB
(m-att);
(SEQ ID NO: 41)
b)
AGCCWGCTTTYKTRTACNAACTSGB
(m-attB);
(SEQ ID NO: 42)
c)
GTTCAGCTTTCKTRTACNAACTSGB
(m-attR);
(SEQ ID NO: 43)
d)
AGCCWGCTTTCKTRTACNAAGTSGB
(m-attL);
(SEQ ID NO: 44)
e)
GTTCAGCTTTYKTRTACNAAGTSGB
(m-attP1);
(SEQ ID NO: 45)
f)
AGCCTGCTTTTTTGTACAAACTTGT
(attB1);
(SEQ ID NO: 46)
g)
AGCCTGCTTTCTTGTACAAACTTGT
(attB2);
(SEQ ID NO: 47)
h)
ACCCAGCTTTCTTGTACAAACTTGT
(attB3);
(SEQ ID NO: 48)
i)
GTTCAGCTTTTTTGTACAAACTTGT
(attR1);
(SEQ ID NO: 49)
j)
GTTCAGCTTTCTTGTACAAACTTGT
(attR2);
(SEQ ID NO: 50)
k)
GTTCAGCTTTCTTGTACAAAGTTGG
(attR3);
(SEQ ID NO: 51)
l)
AGCCTGCTTTTTTGTACAAAGTTGG
(attL1);
(SEQ ID NO: 52)
m)
AGCCTGCTTTCTTGTACAAAGTTGG
(attL2);
(SEQ ID NO: 53)
n)
ACCCAGCTTTCTTGTACAAAGTTGG
(attL3);
(SEQ ID NO: 54)
o)
GTTCAGCTTTTTTGTACAAAGTTGG
(attP1);
(SEQ ID NO: 55)
or
p)
GTTCAGCTTTCTTGTACAAAGTTGG
(attP2);
(SEQ ID NO: 56)
and
q) a corresponding or complementary DNA or RNA sequence to any of a)-p), wherein:
R=A or G, K=G or T/U, Y═C or T/U, W=A or T/U, N=A or C or G or T/U, S=C or G, and B=C or G or T/U; and
a corresponding DNA or RNA sequence effects recombination with a site comprising a sequence of nucleotides set forth in any of a)-p); and
the core region does not contain a stop codon in one or more reading frames.
13. The method of claim 5 , wherein the first and/or second recombination site comprises at least a first nucleic acid sequence selected from the group consisting of:
a mutated att recombination site containing at least one mutation that enhances recombinational specificity relative to the absence of the mutation; and
a nucleic acid molecule whose sequence is complementary to the mutated att recombination site sequence.
14. The method of claim 5 , wherein the vector comprising the second recombination site further encodes at least one selectable marker.
15. The method of claim 14 , wherein the marker is a promoterless marker, which, upon recombination is under the control of a prometer and is thereby expressed.
16. The method of claim 15 , where the first recombination site is attP and is in the sense orientation relative to a promoter on the platform ACes prior to recombination.
17. The method of claim 15 , wherein the selectable marker is selected from the group consisting of a gene that provides a selective growth advantage, an antibiotic resistance gene, and a gene encoding a detectable protein, wherein the detectable protein is chromogenic, fluorescent, or capable of being bound by an antibody and FACs sorted.
18. The method of claim 17 , wherein the selectable marker is selected from the group consisting of green fluorescent protein (GFP), red fluorescent protein (RFP), blue fluorescent protein (BFP), and E. coli histidinol dehydrogenase (hisD).
19. The method of claim 15 . wherein the promoterless marker is transcriptionally downstream of the heterologous nucleic acid, wherein the heterologous nucleic acid encodes a heterologous protein, and
wherein the expression level of the selectable marker is transcriptionally linked to the expression level of the heterologous protein.
20. The method of claim 19 , wherein the selectable marker and the heterologous nucleic acid are transcriptionally linked by the presence of an IRES between them.
21. The method of claim 20 , wherein the selectable marker is selected from the group consisting of a gene that provides a selective growth advantage, an antibiotic resistance gene, and a gene encoding a detectable protein, wherein the detectable protein is chromogenic or fluorescent.
22. The method of claim 21 , wherein the selectable marker is selected from the group consisting of green fluorescent protein (GFP), red fluorescent protein (RFP), blue fluorescent protein (BFP), and E. coli histidinol dehydrogenase.
23. The method of claim 19 , further comprising expressing the heterologous protein and isolating the heterologous protein.
24. The method of claim 5 , wherein the vector is a PCR product comprising a second recombination site.