Methods for modulating lipoprotein and cholesterol levels in humans
Methods for the rapid and long-term lowering of lipid levels in human subjects and for the treatment of conditions associated with elevated LDL-cholesterol and elevated apolipoprotein B are provided.
1 . A method of reducing serum cholesterol levels in a human subject, comprising administering to said subject a plurality of doses of an oligonucleotide comprising the nucleobase sequence “GCCTCAGTCTGCTTCGCACC” (SEQ ID NO: 2), wherein said administering results in a plasma trough AUC from about 2 μg·hr/mL to about 20 μg·hr/mL for the oligonucleotide in said human subject.
2 . The method of claim 1 , wherein said administering results in a plasma trough AUC from about 2 μg·hr/mL to about 10 μg·hr/mL.
3 . The method of claim 1 , wherein said administering results in a plasma trough AUC from about 4 μg·hr/mL to about 6 μg·hr/mL.
4 . The method of claim 1 , wherein said administering results in a plasma trough AUC of about 5 μg·hr/mL.
5 . The method of claims 1 , 2 , 3 or 4 , wherein said plasma trough AUC is achieved from about 3 to about 33 days subsequent to the administration of a dose of said plurality of doses of the oligonucleotide.
6 . The method of claim 1 , wherein said serum cholesterol levels are reduced in said human subject by at least about ten percent.
7 . The method of claim 1 , wherein said serum cholesterol levels are reduced in said human subject by at least about thirty percent.
8 . The method of claim 1 , wherein said serum cholesterol levels are serum low density lipoprotein (LDL) cholesterol levels.
9 . The method of claim 1 , wherein said serum cholesterol levels are serum very low density lipoprotein (VLDL) cholesterol levels.
10 . The method of claim 1 , wherein said oligonucleotide comprises ISIS 301012.
11 . The method of claim 1 , wherein at least one dose of said plurality of doses is administered about once a week.
12 . The method of claim 1 , wherein at least one dose of said plurality of doses is administered about once a month.
13 . The method of claim 1 , wherein said human subject suffers from hypercholesterolemia.
14 . The method of claim 1 , wherein each dose of said plurality of doses comprises from about 50 mg to about 400 mg of the oligonucleotide.
15 . The method of claim 1 , wherein each dose of said plurality of doses comprises about 200 mg of the oligonucleotide.
16 . A method of reducing serum cholesterol levels in a human subject, comprising administering to said subject a plurality of doses of an oligonucleotide comprising the nucleobase sequence “GCCTCAGTCTGCTTCGCACC” (SEQ ID NO: 2), wherein said administering results in a plasma trough concentration from about 5 ng/mL to about 40 ng/mL of the oligonucleotide in said human subject.
17 . The method of claim 16 , wherein said administering results in a plasma trough concentration from about 5 ng/mL to about 20 ng/mL.
18 . The method of claims 16 or 17, wherein said plasma trough concentration is achieved about 7 days subsequent to the administration of a dose of said plurality of doses of the oligonucleotide.
19 . The method of claim 16 , wherein said serum cholesterol levels are reduced in said human subject by at least about ten percent.
20 . The method of claim 16 , wherein said serum cholesterol levels are reduced in said human subject by at least about thirty percent.
21 . The method of claim 16 , wherein said serum cholesterol levels are low density lipoprotein (LDL) cholesterol levels.
22 . The method of claim 16 , wherein said serum cholesterol levels are very low density lipoprotein (VLDL) cholesterol levels.
23 . The method of claim 16 , wherein said oligonucleotide comprises ISIS 301012.
24 . The method of claim 16 , wherein at least one dose of said plurality of doses is administered about once a week.
25 . The method of claim 16 , wherein at least one dose of said plurality of doses is administered about once a month.
26 . The method of claim 16 , wherein said human subject suffers from hypercholesterolemia.
27 . The method of claim 16 , wherein each dose of said plurality of doses comprises from about 50 mg to about 400 mg of the oligonucleotide.
28 . The method of claim 16 , wherein each dose of said plurality of doses comprises about 200 mg of the oligonucleotide.
29 . A method of reducing serum cholesterol levels in a human subject, comprising:
selecting a human subject previously unsuccessfully treated by a statin; and
administering to said human subject an oligonucleotide comprising the nucleobase sequence “GCCTCAGTCTGCTTCGCACC” (SEQ ID NO: 2).
30 . The method of claim 29 , wherein said serum cholesterol levels are serum LDL-cholesterol levels.
31 . The method of claim 29 , wherein the human subject is intolerant to a statin.
32 . The method of claim 29 , wherein the subject has experienced adverse effects resulting from treatment with said statin.
33 . The method of claim 32 , wherein the subject has experienced myopathy, fatigue, Central Nervous System (CNS) effects resulting from treatment with said statin or any combination of myopathy, fatigue, and CNS effects resulting from treatment with said statin.
34 . The method of claim 29 , wherein the human subject has insufficient LDL-receptor activity.
35 . The method of claim 29 , wherein said oligonucleotide comprises ISIS 301012.