Methods and compositions for inducing innate immune responses
The invention relates to TLR ligand formulations that comprise immune stimulating complexes and their use in inducing innate immunity.
1 - 52 . (canceled)
53 . A method for reducing tumor size, comprising
administering to a subject in need thereof a CpG oligonucleotide comprising a nucleotide sequence of
5′ TCGTCGTTTTGTCGTTTTGTCGTT 3′ (SEQ ID NO: 1)
and an immune stimulating complex, and an anti-cancer agent in an amount effective to reduce tumor size, wherein the CpG oligonucleotide and the immune stimulating complex are administered by a route different from the anti-cancer agent.
54 . The method of claim 53 , wherein the ratio of CpG oligonucleotide to immune stimulating complex is 100:1 or 20:1
55 . A method for reducing tumor size, comprising
administering to a subject in need thereof a CpG oligonucleotide comprising a nucleotide sequence of
5′ TCGTCGTTTTGTCGTTTTGTCGTT 3′ (SEQ ID NO: 1)
and an immune stimulating complex, and an anti-cancer agent in an amount effective to reduce tumor size, wherein the CpG oligonucleotide and the immune stimulating complex are present in a ratio of 20:1 or 100:1.
56 . The method of claim 53 , wherein the CpG oligonucleotide has a modified phosphate backbone.
57 . The method of claim 56 , wherein the modified phosphate backbone is partially or wholly modified.
58 . The method of claim 56 , wherein the modified phosphate backbone comprises a phosphorothioate modification.
59 . The method of claim 53 , wherein the CpG oligonucleotide comprises a palindrome.
60 . The method of claim 53 , wherein the subject has a cancer selected from the group consisting of biliary tract cancer, bone cancer, brain and CNS cancer, breast cancer, cervical cancer, choriocarcinoma, colon cancer, connective tissue cancer, endometrial cancer, esophageal cancer, eye cancer, gastric cancer, Hodgkin's lymphoma, intraepithelial neoplasm, larynx cancer, liver cancer, small cell lung cancer, non-small cell lung cancer, lymphoma, melanoma, neuroblastoma, oral cancer, oral cavity cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, renal cancer, skin cancer, testicular cancer and thyroid cancer.
61 . The use of claim 53 , wherein the cancer is selected from the group consisting of breast cancer, lung cancer, melanoma, ovarian cancer, and renal cancer.
62 . The use of claim 61 , wherein the cancer is lung cancer.
63 . The use of claim 61 , wherein the lung cancer is non-small cell lung cancer.
64 . (canceled)
65 . The method of claim 53 , wherein the CpG oligonucleotide and the immune stimulating complex are administered parenterally.
66 . The method of claim 53 , wherein the CpG oligonucleotide and the immune stimulating complex are administered subcutaneously.
67 . The method of claim 53 , wherein the anti-cancer agent is administered intra-peritoneally.
68 . The method of claim 53 , wherein the CpG oligonucleotide is mixed together with the immune stimulating complex prior to administration.
69 . The method of claim 53 , wherein the immune stimulating complex further comprises a phospholipid.
70 . The method of claim 53 , wherein the CpG oligonucleotide is sterol-linked, phospholipid-linked or glycoside-linked.
71 . The method of claim 70 , wherein the sterol-linked CpG oligonucleotide replaces a sterol in the immune stimulating complex.
72 . The method of claim 70 , wherein the glycoside-linked CpG oligonucleotide is a saponin-linked CpG oligonucleotide.
73 . The method of claim 72 , wherein the saponin-linked CpG oligonucleotide replaces a saponin in the immune stimulating complex.
74 . The method of claim 53 , wherein the anti-cancer agent is a chemotherapeutic agent.
75 . The method of claim 74 , wherein the chemotherapeutic agent is taxol.
76 . The method of claim 74 , wherein the chemotherapeutic agent is cisplatin.
77 . The method of claim 74 , wherein the chemotherapeutic agent is carboplatin.
78 . The method of claim 74 , wherein the chemotherapeutic agent is 5-fluorouracil (5-FU).
79 . The method of claim 74 , wherein the chemotherapeutic agent is paclitaxel.
80 . The method of claim 79 , wherein the paclitaxel is oral paclitaxel.
81 . The method of claim 74 , wherein the chemotherapeutic agent is oral taxoid.
82 . The method of claim 74 , wherein the chemotherapeutic agent is capecitabine.
83 . The method of claim 74 , wherein the chemotherapeutic agent is gemcitabine.
84 . The method of claim 53 , wherein the anti-cancer therapy is an immunotherapeutic agent.
85 . The method of claim 84 , wherein the immunotherapeutic agent is herceptin.
86 . The method of claim 84 , wherein the immunotherapeutic agent is C225.
87 . The method of claim 84 , wherein the immunotherapeutic agent is anti-VEGF.
88 . The method of claim 84 , wherein the immunotherapeutic agent is MDX-210.
89 . The method of claim 84 , wherein the immunotherapeutic agent is MDX-220.
90 . The method of claim 84 , wherein the immunotherapeutic agent is EMD-72000.