Immunostimulatory oligonucleotides
View Patent ↗The invention relates to immunostimulatory oligonucleotides and methods of using immunostimulatory oligonucleotides to induce an antigen-specific immune response. The invention further relates to a vaccine that comprises an immunostimulatory oligonucleotide and an antigen, and comprises a pharmaceutically acceptable carrier. The immunostimulatory oligonucleotides of the invention, in some embodiments, include one or more modified linkage(s).
1. An immunostimulatory oligonucleotide comprising the nucleotide sequence
5′ TCGTCGTTTTTCGGTGCTTTT 3′.
(SEQ ID NO: 1)
2. The immunostimulatory oligonucleotide of claim 1 , wherein the oligonucleotide comprises one or more modified linkages.
3. The immunostimulatory oligonucleotide of claim 2 , wherein the oligonucleotide comprises one or more phosphorothioate linkages.
4. The immunostimulatory oligonucleotide of claim 1 , wherein the oligonucleotide comprises at least one lipophilic substituted nucleotide analog and a pyrimidine-purine dinucleotide.