Aptamers to 4-1BB and Their Use in Treating Diseases and Disorders
The present disclosure relates generally to the field of nucleic acids and, more particularly, to aptamers capable of binding to 4-1BB; pharmaceutical compositions comprising such 4-1BB aptamers; and methods of making and using the same.
1 . A composition comprising:
CCCWCWAGX
wherein
X=G or C;
W is an independently selected modified pyrimidine; and
C is an independently selected modified cytidine.
2 . A composition comprising
YCGGAWGZ
wherein
X=G or C;
Y=C or G;
Z=C or W
W is an independently selected modified pyrimidine; and
C is an independently selected modified cytidine.
3 . The composition of claim 1 or 2 , wherein said modified pyrimidine is a C-5 modified pyrimidine and said modified cytidine is a C-5 modified cytidine.
4 . The composition of claim 3 wherein said C-5 modified pyrimidine is selected from the group consisting of FIG. 3 .
5 . The composition of claim 3 , wherein said C-5 modified pyrimidine is selected from the group consisting of 5-(N-benzylcarboxyamide)-2′-deoxyuridine (BndU), 5-(N-isobutylcarboxyamide)-2′-deoxyuridine (iBudU), 5-(N-tryptaminocarboxyamide)-2′-deoxyuridine (TrpdU) and 5-(N-naphthylmethylcarboxyamide)-2′-deoxyuridine (NapdU).
6 . The composition of claim 3 , wherein said C-5 modified pyrimidine is 5-(N-tryptaminocarboxyamide)-2′-deoxyuridine (TrpdU).
7 . The composition of claims 3 to 6 , wherein said C-5 modified cytidine is 5-methylcytidine.
8 . An aptamer comprised of a sequence selected from:
5′-5 f(n) -CCCWCWAGX-L1 (n) -YCGGAWGZ-3 f(n) -3′
3′-3 f(n) -CCCWCWAGX-L2 (n) -YCGGAWGZ-5 f(n) -5′
wherein
X=G or C;
Y=G or C;
Z=C or W;
wherein
W is an independently selected modified pyrimidine; and
C is an independently selected modified cytidine;
wherein
3 f , 5 f , L1 and L2 are independently selected from a nucleotide (N), a spacer sequence, or a combination thereof;
wherein said spacer sequence is selected from a non-nucleotide small molecule covalently bound to either end of the consensus regions; and
n=an integer from 0-100.
9 . The aptamer of claim 8 , wherein said modified pyrimidine is a C-5 modified pyrimidine and said modified cytidine is a C-5 modified cytidine.
10 . The aptamer of claim 9 , wherein said C-5 modified pyrimidine is selected from the group consisting of FIG. 3 .
11 . The aptamer of claim 9 , wherein said C-5 modified pyrimidine is selected from the group consisting of 5-(N-benzylcarboxyamide)-2′-deoxyuridine (BndU), 5-(N-isobutylcarboxyamide)-2′-deoxyuridine (iBudU), 5-(N-tryptaminocarboxyamide)-2′-deoxyuridine (TrpdU) and 5-(N-naphthylmethylcarboxyamide)-2′-deoxyuridine (NapdU).
12 . The aptamer of claim 8 , wherein said C-5 modified pyrimidine is 5-(N-tryptaminocarboxyamide)-2′-deoxyuridine (TrpdU).
13 . The aptamer of claims 8 - 12 , wherein said C-5 modified cytidine is 5-methylcytidine.
14 . The aptamer of claims 8 - 13 , wherein said small molecules form a spacer sequence selected from the group consisting of a polyethylene glycol, a hydrocarbon chain, or other polymer or copolymer.
15 . An aptamer comprised of the sequence 5′-CCCTCTAGXN (0-40) YCGGATGZ-3′ or a fragment thereof:
wherein
X=G or C;
Y=G or C;
Z=C or T;
T=TrpdU;
C=MdC
N is independently selected from a naturally occurring nucleotide, a modified nucleotide, or a spacer sequence.
16 . The aptamer of claims 8 - 15 , wherein the aptamer binds to 4-1BB.
17 . The aptamer of claim 16 , wherein said aptamer has a Kd for 1-1BB of 50 nm or less.
18 . The aptamer of claim 16 , wherein said aptamer has the ability to inhibit the binding of 4-1BB to a 4-1BB receptor ligand (4-1BBL).
19 . An aptamer that binds to 4-1BB comprising a sequence selected from the group consisting of SEQ. ID. NOS: 4-13.
20 . The aptamer of claim 19 , wherein said aptamer has the ability to inhibit the binding of 4-1BB to a 4-1BB receptor ligand (4-1BBL).
21 . The aptamer of claim 20 , wherein the sequence is selected from the group consisting of at least about 90% identity, at least about 91% identity, at least about 92% identity, at least about 93% identity, at least about 94% identity, and at least about 95% identity.
22 . A pharmaceutical composition comprising an aptamer to 4-1BB comprised of the sequence 5′-CCCTCTAGXN (0-40) YCGGATGZ-3′, or a pharmaceutically acceptable salt thereof or a fragment thereof:
wherein
X=G or C;
Y=G or C;
Z=C or T;
T=TrpdUTP;
C=MdC
N is independently selected from a naturally occurring oligonucleotide, a modified nucleotide, or a small molecule.
23 . A pharmaceutical composition comprising an aptamer to 4-1BB comprised of the sequences selected from the group consisting of SEQ. ID. NOS: 4-13, or a pharmaceutically acceptable salt thereof or a fragment thereof.
24 . A pharmaceutical composition comprising an aptamer to 4-1BB comprised of the sequence CCTGCACCCAGTGTCCCCGACGGGGCCCTCTAGCCGTACTCTGTAATGG CGGATGCTGACGGAGAGGAGGACGG (SEQ ID NO:5); or a pharmaceutically acceptable salt thereof or a fragment thereof.
25 . The compositions of claims 22 to 24 , further comprising a pharmaceutically acceptable carrier or excipient.