IP Library Granted Patent US 9,340,786
Granted Patent B2
US 9,340,786 · App. 13/636,755 · Granted May 17, 2016

RNA interference in dermal and fibrotic indications

Inventors: Anastasia Khvorova (Westborough, MA); William Salomon (Worcester, MA); Joanne Kamens (Newton, MA); Dmitry Samarsky (Westborough, MA); Tod M. Woolf (Sudbury, MA); Pamela A. Pavco (Longmont, CO); Lyn Libertine (Framingham, MA); James Cardia (Franklin, MA); Karen G. Bulock (Mendon, MA)
Assignee: RXi Pharmaceuticals Corporation
C12N15/1136C12N15/113C12N2310/14C12N2310/315C12N2310/3341C12N2310/3515C12N2320/32C12N2320/52
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 9,340,786
App. No.
13/636,755
Granted
May 17, 2016
Kind
B2
Abstract

The present invention relates to RNAi constructs with improved tissue and cellular uptake characteristics and methods of use of these compounds in dermal and fibrotic applications.

Claims (26)

1. A double-stranded ribonucleic acid (dsRNA) directed against CTGF comprising a sense strand and an antisense strand wherein the sense strand comprises at least 12 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NOs: 2463 (GCACCUUUCUAGA), 3429 (G.mC. A.mC.mC.mU.mU.mU.mC.mU. A*mG*mA.TEG-Chl), 2443 (UUGCACCUUUCUAA), 3445 (mU.mU.G.mC.A.mC.mC.mU.mU.mU.mC.mU*mA* mA.TEG-Chl), 2465 (CCUUUCUAGUUGA), and 3469 (mC.mC.mU.mU.mU.mC.mU. A. G.mU.mU*mG*mA.TEG-Chl) and/or wherein the antisense strand comprises at least 12 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NOs: 2464 (UCUAGAAAGGUGCAAACAU), 3430 (P.mU.fC.fU. A. G.mA. A.mA. G. G.fU. G.mC* A* A* A*mC* A* U), 4203 (UUAGAAAGGUGCAAACAAGG), 3446 (P.mU.fU. A. G. A.mA. A. G. G.fU. G.fC.mA.mA*mA*fC*mA*mA*mG* G.), 2466 (UCAACUAGAAAGGUGCAAA), and 3470 (P.mU.fC. A. A.fC.fU. A. G. A.mA. A. G. G*fU*mG*fC*mA*mA* A.), wherein the dsRNA is an sd-rxRNA,

wherein the antisense strand is 16-23 nucleotides long and the sense strand is 8-15 nucleotides long, wherein the sd-rxRNA includes a double stranded region and a single stranded region, wherein the double stranded region is from 8-15 nucleotides long, wherein the single stranded region is at the 3′ end of the antisense strand and is 4-12 nucleotides long, wherein the single stranded region contains 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 phosphorothioate modifications, and wherein at least 40% of the nucleotides of the isolated double stranded nucleic acid molecule are modified.

2. The dsRNA of claim 1 , wherein the sense strand comprises SEQ ID NO:2463 (GCACCUUUCUAGA) and the antisense strand comprises SEQ ID NO:2464 (UCUAGAAAGGUGCAAACAU).

3. The dsRNA of claim 1 , wherein the sense strand comprises SEQ ID NO:3429 (G.mC. A.mC.mC.mU.mU.mU.mC.mU. A*mG*mA.TEG-Chl) and the antisense strand comprises SEQ ID NO:3430 (P.mU.fC.fU. A. G.mA. A.mA. G. G.fU. G.mC* A* A* A*mC* A* U).

4. The dsRNA of claim 1 , wherein the sense strand comprises SEQ ID NO:2443 (UUGCACCUUUCUAA) and the antisense strand comprises SEQ ID NO:4203 (UUAGAAAGGUGCAAACAAGG), the sense strand comprises SEQ ID NO:3445 (mU.mU. G.mC. A.mC.mC.mU.mU.mU.mC.mU*mA*mA.TEG-Chl) and the antisense strand comprises SEQ ID NO:3446 (P.mU.fU. A. G. A.mA. A. G. G.fU. G.fC.mA.mA*mA*fC*mA*fC*mA*mA*mG* G.), the sense strand comprises SEQ ID NO:2465 (CCUUUCUAGUUGA) and the antisense strand comprises SEQ ID NO:2466 (UCAACUAGAAAGGUGCAAA) or the sense strand comprises SEQ ID NO:3469 (mC.mC.mU.mU.mU.mC.mU. A. G.mU.mU*mG*mA.TEG-Chl) and the antisense strand comprises SEQ ID NO:3470 (P.mU.fC. A. A.fC.fU. A. G. A.mA. A. G. G*fU*mG*fC*mA*mA* A.).

5. The dsRNA of claim 1 , wherein the dsRNA is hydrophobically modified and/or wherein the dsRNA is linked to a hydrophobic conjugate.

6. A composition comprising the dsRNA of claim 1 , optionally wherein the composition comprises dsRNA directed against genes encoding for more than one protein.

7. The composition of claim 1 wherein the composition is formulated for delivery to the skin, for topical delivery, for intradermal injection and/or wherein the composition is in a neutral formulation.

8. A method comprising delivering the dsRNA of claim 1 to the skin of a subject in need thereof.

9. A method comprising,

administering to a subject in need thereof a therapeutically effective amount of a double stranded ribonucleic acid (dsRNA) directed against CTGF comprising a sense strand and an antisense strand wherein the sense strand comprises at least 12 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NOs: 2463 (GCACCUUUCUAGA), 3429 (G.mC. A.mC.mC.mU.mU.mU.mC.mU. A*mG*mA.TEG-Chl), 2443 (UUGCACCUUUCUAA), 3445 (mU.mU. G.mC. A.mC.mC.mU.mU.mU.mC.mU*mA*mA.TEG-Chl), 2465 (CCUUUCUAGUUGA), and 3469 (mC.mC.mU.mU.mU.mC.mU. A. G.mU.mU*mG*mA.TEG-Chl) and/or wherein the antisense strand comprises at least 12 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NOs: 2464 (UCUAGAAAGGUGCAAACAU), 3430 (P.mU.fC.fU. A. G.mA. A.mA. G. G.fU. G.mC* A* A* A*mC* A* U), 4203 (UUAGAAAGGUGCAAACAAGG), 3446 (P.mU.fU. A. G. A.mA. A. G. G.fU. G.fC.mA.mA*mA*fC*mA*mA*mG* G.), 2466 (UCAACUAGAAAGGUGCAAA), and 3470 (P.mU.fC. A. A.fC.fU. A. G. A.mA. A. G. G*fU*mG*fC*mA*mA* A.), wherein the dsRNA is an sd-rxRNA,

wherein the antisense strand is 16-23 nucleotides long and the sense strand is 8-15 nucleotides long, wherein the sd-rxRNA includes a double stranded region and a single stranded region, wherein the double stranded region is from 8-15 nucleotides long, wherein the single stranded region is at the 3′ end of the antisense strand and is 4-12 nucleotides long, wherein the single stranded region contains 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 phosphorothioate modifications, and wherein at least 40% of the nucleotides of the isolated double stranded nucleic acid molecule are modified.

10. The method of claim 9 , wherein the dsRNA is administered via intradermal injection or is administered locally to the skin.

11. The method of claim 9 , wherein the dsRNA is hydrophobically modified and/or is linked to a hydrophobic conjugate.

12. A double-stranded ribonucleic acid (dsRNA) directed against CTGF comprising a sense strand and an antisense strand wherein the sense strand comprises at least 12 contiguous nucleotides of SEQ ID NOs: 2459 (GUGACCAAAAGUA) or 3493 (G.mU. G. A.mC.mC. A. A. A. A. G*mU*mA.TEG-Chl) and/or wherein the antisense strand comprises at least 12 contiguous nucleotides of SEQ ID NOs: 2460 (UACUUUUGGUCACACUCUC) or 3494 (P.mU. A.fC.fU.fU.fU.fU. G. G.fU.mC. A.mC* A*mC*mU*mC*mU* C.), wherein the dsRNA is an sd-rxRNA,

wherein the antisense strand is 16-23 nucleotides long and the sense strand is 8-15 nucleotides long, wherein the sd-rxRNA includes a double stranded region and a single stranded region, wherein the double stranded region is from 8-15 nucleotides long, wherein the single stranded region is at the 3′ end of the antisense strand and is 4-12 nucleotides long, wherein the single stranded region contains 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 phosphorothioate modifications, and wherein at least 40% of the nucleotides of the isolated double stranded nucleic acid molecule are modified.

13. The dsRNA of claim 12 , wherein the sense strand comprises SEQ ID NO:2459 (GUGACCAAAAGUA) and the antisense strand comprises SEQ ID NO:2460 (UACUUUUGGUCACACUCUC), or the sense strand comprises SEQ ID NO:3493 (G.mU. G. A.mC.mC. A. A. A. A. G*mU*mA.TEG-Chl) and the antisense strand comprises SEQ ID NO:3494 (P.mU. A.fC.fU.fU.fU.fU. G. G.fU.mC. A.mC* A*mC*mU*mC*mU* C.).

14. The dsRNA of claim 12 , wherein the dsRNA is hydrophobically modified and/or wherein the dsRNA is linked to a hydrophobic conjugate.

15. A composition comprising the dsRNA of claim 12 , optionally wherein the composition comprises dsRNA directed against genes encoding for more than one protein.

16. The composition of claim 15 wherein the composition is formulated for delivery to the skin, for topical delivery, for intradermal injection and/or wherein the composition is in a neutral formulation.

17. A method comprising delivering the dsRNA of claim 12 to the skin of a subject in need thereof.

18. A method comprising,

administering to a subject in need thereof a therapeutically effective amount of a double stranded ribonucleic acid (dsRNA) directed against CTGF comprising a sense strand and an antisense strand wherein the sense strand comprises at least 12 contiguous nucleotides of SEQ ID NOs: 2459 (GUGACCAAAAGUA) or 3493 (G.mU. G. A.mC.mC. A. A. A. A. G*mU*mA.TEG-Chl) and/or wherein the antisense strand comprises at least 12 contiguous nucleotides of SEQ ID NOs: 2460 (UACUUUUGGUCACACUCUC) or 3494 (P.mU. A.fC.fU.fU.fU.fU. G. G.fU.mC. A.mC* A*mC*mU*mC*mU* C.), wherein the dsRNA is an sd-rxRNA,

wherein the antisense strand is 16-23 nucleotides long and the sense strand is 8-15 nucleotides long, wherein the sd-rxRNA includes a double stranded region and a single stranded region, wherein the double stranded region is from 8-15 nucleotides long, wherein the single stranded region is at the 3′ end of the antisense strand and is 4-12 nucleotides long, wherein the single stranded region contains 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 phosphorothioate modifications, and wherein at least 40% of the nucleotides of the isolated double stranded nucleic acid molecule are modified.

19. The method of claim 18 , wherein the dsRNA is administered via intradermal injection or is administered locally to the skin.

20. The method of claim 18 , wherein the dsRNA is hydrophobically modified and/or is linked to a hydrophobic conjugate.

Assignments (2)
CHANGE OF NAME Recorded Dec 7, 2018
From: RXI PHARMACEUTICALS CORPORATION
To: PHIO PHARMACEUTICALS CORP.
Reel/Frame 048380/0009 →
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Oct 31, 2013
From: KHVOROVA, ANASTASIA; SALOMON, WILLIAM; KAMENS, JOANNE; SAMARSKY, DMITRY; WOOLF, TOD M.; PAVCO, PAMELA A.; LIBERTINE, LYN; CARDIA, JAMES; BULOCK, KAREN G.
To: RXI PHARMACEUTICALS CORPORATION
Reel/Frame 031518/0639 →
Continuity (3)
Provisional Application 61317633 · Mar 25, 2010
Provisional Application 61317252 · Mar 24, 2010
Related Publication 20140113950A1 · Apr 24, 2014