NOVEL MICRORNAS FOR THE DETECTION AND ISOLATION OF HUMAN EMBRYONIC STEM CELL-DERIVED CARDIAC CELL TYPES
The present invention relates to the use of human-derived microRNAs (miRNAs) as targets for the identification of cardiac and cardiac-like cell types. In particular, it relates to a specific set of miRNAs which have been found to be correlated to cardiac differentiation and can act to up or downregulate a number of putative mRNA targets to guide differentiation and also act as markers for a cardiac phenotype. In addition, it also relates to the use of these miRNAs as tools for the isolation, selection, purification and characterisation of cardiac and cardiac-like cells and tissues. The invention also encompasses the possible use of these miRNAs in the differentiation and maturation of cardiac or cardiac-like cell types.
1 . A method for promoting the development and/or maturation of stem cells towards cardiac progenitor or cardiomyocyte-like cells in vitro, by manipulating the intracellular level of one or more miRNAs.
2 . The method according to claim 1 , wherein at least one or more of the miRNAs belongs to the group consisting of the miRNAs which are upregulated and/or downregulated in CMC3w.
3 . The method according to claim 1 , wherein at least one or more of the miRNAs belongs to the group consisting of the miRNAs which are upregulated and/or downregulated in CMC7w.
4 . The method according to claim 1 , wherein at least one or more of the miRNAs belongs to the group consisting of the miRNAs which are upregulated and/or downregulated in foetal heart.
5 . The method according to claim 1 , wherein at least one or more of the miRNAs belongs to the group consisting of the miRNAs which are upregulated and/or downregulated in adult heart.
6 . The method according to claim 1 , wherein at least one or more of the miRNAs belongs to the group consisting of the miRNAs which are upregulated and/or downregulated in both CMC3w and CMC7w.
7 . The method according to claim 1 , wherein at least one or more of the miRNAs belongs to the group consisting of the miRNAs which are upregulated and/or downregulated in CMC3w, CMC7w and Foetal Heart (FH).
8 . The method according to claim 1 , wherein at least one or more of the miRNAs belongs to the group consisting of the miRNAs which are upregulated and/or downregulated in CMC3w, CMC7w, Foetal Heart (FH) and Adult Heart (AH).
9 . The method according to claim 1 wherein the one or more miRNAs is selected from the group consisting of miR-378, miR-152, miR-1297, miR-208a, miR-208b, miR-451, miRPlus-E1117, miRPlus-E1141, miRPlus-E1202, miR-25*, miRPlus-E1038, and miRPlus-1047.
10 . The method according to claim 1 , wherein the development and/or maturation of stem cell towards cardiac or cardiomyocyte-like cells is done through up or downregulation of one or more endogenous miRNAs.
11 . The method according to claim 1 , wherein the development and/or maturation of stem cells towards cardiac or cardiomyocyte-like cells is done through the introduction into the cell of one or more miRNAs.
12 . The method according to claim 1 , wherein the development and/or maturation of stem cells towards cardiac or cardiomyocyte-like cells is done through introducing into a stem cell or progenitor cell a miRNA antagomir.
13 . The method according to claim 1 , wherein the miRNAs are introduced as an nucleotide construct such as an expression construct, as a solution of miRNAs and/or as viral constructs.
14 . The method according to claim 1 , wherein the miRNA is a nucleotide analogue.
15 . The method according to claim 1 , wherein the miRNA or miRNA analogue is an miRNA antagomir.
16 . The method according to claim 1 , wherein the nucleic acid encoding the miRNA is linked to an inducible promoter sequence.
17 . The method according to claim 1 , wherein where the miRNA material is a purified miRNA sequence.
18 . A method for in vitro diagnosing cardiac abnormalities and disease states in a sample, comprising the detection of alterations in the levels of at least one miRNA within the diseased cells compared to a control group.
19 . A method for detecting and characterising stem cells as cardiac or cardiac-like cells within a stem cell population, comprising:
a) analysing the cellular level of one or more miRNAs.
20 . A method for isolating stem cells exhibiting cardiac or cardiac-like characteristics from a heterogeneous mixed-cell population using one or more microRNAs, comprising:
a) analysing the level of one or more intracellular miRNAs;
b) optionally, removing unwanted cells;
c) mechanically and/or enzymatically isolating the cells showing signs of cardiac differentiation; and
d) optionally, adding substances such as e.g. growth factors or differentiating agents to the growth medium to promote differentiation towards a cardiomyocyte cell fate.
21 . The method according to claim 19 or claim 20 , wherein at least one or more of the miRNAs belongs to the group consisting of the miRNAs which are upregulated and/or downregulated in CMC3w.
22 . The method according to claim 19 or claim 20 , wherein at least one, or more of the miRNAs belongs to the group consisting of the miRNAs which are upregulated and/or downregulated in CMC7w.
23 . The method according to claim 19 or claim 20 , wherein at least one or more of the miRNAs belongs to the group consisting of the miRNAs which are upregulated and/or downregulated in foetal heart.
24 . The method according to claim 19 or claim 20 , wherein at least one or more of the miRNAs belongs to the group consisting of the miRNAs which are upregulated and/or downregulated in adult heart.
25 . The method according to claim 19 or claim 20 , wherein at least one or more of the miRNAs belongs to the group consisting of the miRNAs which are upregulated and/or downregulated in CMC3w.
26 . The method according to claim 19 or claim 20 , wherein at least one or more of the miRNAs belongs to the group consisting of the miRNAs which are upregulated and/or downregulated in both CMC3w and CMC7w.
27 . The method according to claim 19 or claim 20 , wherein at least one or more of the miRNAs belongs to the group consisting of the miRNAs which are upregulated and/or downregulated in CMC3w, CMC7w and Foetal Heart (FH).
28 . The method according to claim 19 or claim 20 , wherein at least one or more of the miRNAs belongs to the group consisting of the miRNAs which are upregulated and/or downregulated in CMC3w, CMC7w, Foetal Heart (FH) and Adult Heart (AH).
29 . The method according to claim 19 , wherein the one or more miRNAs is selected from the group consisting of miR-378, miR-152, and miR-1297.
30 . The method according to claim 1 or claim 19 , wherein the stem cells are human pluripotent (hPS) stem cells.
31 . The method according to claim 1 or claim 19 , wherein the stem cells are induced pluripotent stem cells (iPS).
32 . The method according to claim 1 or claim 19 , wherein the stem cells are derived from a primary mammalian source.
33 . The method according to claim 19 , wherein the levels of miRNA markers are compared to a reference.
34 . The method according to claim 19 , wherein, the miRNA is an expression construct and wherein the miRNA encoding sequence, the promoter driving the expression of the miRNA sequence or the miRNA target sequence is fused to an exogenous reporter gene sequence.
35 . A genetically modified cell, containing a nucleotide construct comprising a miRNA selected from any of the tables 1.i) to 1.xiv).
36 . The genetically modified cell according to claim 35 , wherein the miRNA encoding sequence or promoter or miRNA target sequence is fused to a reporter gene sequence.
37 . The genetically modified cell according to claim 36 , wherein the reporter gene sequence is of non-human origin.
38 . The genetically modified cell according to claim 35 , wherein the nucleotide construct is stably integrated into the cell genome.
39 . The genetically-modified cell or progenitor cell according to claim 35 , wherein the miRNA expression construct is transiently expressed.
40 . An isolated cell obtained by the method as described in claim 1 .
41 . An isolated cell exhibiting cardiac or cardiac-like characteristics growing in an in vitro environment comprising miRNAs or miRNA antagomir.
42 . The isolated cell according to claim 41 growing in an in vitro environment comprising one or more miRNAs selected from any of the tables 1.i) to 1.xiv) or miRNA antagomirs targeting miRNA selected from any of the tables 1.i) to 1.xiv).
43 . The isolated cell according to claim 40 , wherein the cell is a pluripotent stem cell, such as e.g., an induced pluripotent stem cell or a blastocyst derived stem cell.
44 . The isolated cell according to claim 40 , wherein the miRNA or miRNA antagomir is exogenously added or a synthetic construct.
45 . An isolated in vitro derived stem cell according to claim 41 , wherein the one or more miRNAs is exogenously added.
46 . miRNA for use as a marker of cardiomyocyte differentiation.
47 . One or more of the miRNA Sequences:
miRPlus-E1117:
AAGACGAGAAGACCCUAUGGAGCUU,
miRPlus-E1141:
GCGUAAAGAGUGUUUUAGAUCACCC;
miRPlus-E1202:
GAUUAGGGUGCUUAGCUGUUAACU;
miRPlus-E1038:
GCAUGAGUGGUUCAGUGGU;
and
miRPlus-E1047:
GCUGAGUGAAGCAUUGGACUGU.
48 . Use of any of the miRNA Sequences:
miRPlus-E1117: AAGACGAGAAGACCCUAUGGAGCUU;
miRPlus-E1141: GCGUAAAGAGUGUUUUAGAUCACCC;
miRPlus-E1202: GAUUAGGGUGCUUAGCUGUUAACU;
miRPlus-E1038: GCAUGAGUGGUUCAGUGGU;
miRPlus-E1047: GCUGAGUGAAGCAUUGGACUGU; and
for detecting, characterising, isolating, or differentiating hPS cells.
49 . Use of any of the miRNA Sequences:
miRPlus-E1117: AAGACGAGAAGACCCUAUGGAGCUU;
miRPlus-E1141: GCGUAAAGAGUGUUUUAGAUCACCC;
miRPlus-E1202: GAUUAGGGUGCUUAGCUGUUAACU;
miRPlus-E1038: GCAUGAGUGGUUCAGUGGU;
miRPlus-E1047: GCUGAGUGAAGCAUUGGACUGU; and
in diagnostics, drug discovery, toxicity testing, or drug development.