MIR27B is a novel target for treatment of liver fibrosis
View Patent ↗Methods are provided for treating fibrosis of a tissue, including fibrosis of the liver, using combinations of antagomirs and/or locked nucleic acids. Compositions therefor are also provided.
1. A method of treating liver fibrosis in a subject, or of reducing development of liver fibrosis of a tissue in a subject at risk of liver fibrosis, comprising administering to the subject an amount of a combination of three different molecules, each molecule being, independently, a nucleic acid or nucleic acid analogue targeted to microRNAs chosen from miR-23b, miR-27b and miR-24, wherein the combination comprises three different molecules each directed to a different one of miR-23b, miR-27b and miR-24, effective to treat liver fibrosis or to reduce development of liver fibrosis.
2. The method of claim 1 , wherein the three different molecules are nucleic acids, each complementary to the microRNA it is targeted to.
3. The method of claim 2 , wherein the nucleic acids are antagomirs, each fully complementary to the microRNA it is targeted to.
4. The method of claim 1 , wherein the three different molecules are nucleic acid analogues, each complementary to the microRNA they are targeted to, wherein the nucleic acid analogues are analogues by virtue of comprising a methylene bridge connecting a 2′-O atom and a 4′-C atom of at least one ribose thereof.
5. The method of claim 4 , wherein the three different nucleic acids analogues are each fully complementary to the microRNA they are targeted to.
6. The method of claim 1 , wherein the nucleic acids are ribonucleic acids.
7. The method of claim 1 , wherein the miR-23b has the sequence AUCACAUUGCCAGGGAUUACC (SEQ ID NO:1), wherein the miR-27b has the sequence UUCACAGUGGCUAAGUUCUGC (SEQ ID NO:2), and wherein the miR-24 has the sequence UGGCUCAGUUCAGCAGGAACAG (SEQ ID NO:3).
8. The method of claim 1 , wherein the three different molecules have sequences chosen from:
(SEQ ID NO: 4)
mG*mG*mUmAmAmUmCmCmCmUmGmGmCmAmAmUmGmU*mG*mA*mU*;
(SEQ ID NO: 6)
mG*mC*mAmGmAmAmCmUmUmAmGmCmCmAmCmUmGmU*mG*mA*mA*;
and
(SEQ ID NO: 8)
mC*mU*mGmUmUmCmCmUmGmCmUmGmAmAmCmUmGmAmG*mC*mC*mA*.
9. The method of claim 1 , wherein one, more than one, or all of the nucleic acids or nucleic acid analogues are covalently bonded to a cholesterol at their 3′ end.
10. The method of claim 1 , wherein the liver is cirrhosed.