NUCLEIC ACIDS AND METHODS FOR DETECTING TURFGRASS PATHOGENIC FUNGI
The present invention relates to the use of at least one nucleic acid comprising or consisting of: (i) (SEQ ID NO: 1) CATCGATGAAGAACGCWGCRAAHTGCGATAMGTARTGYGAATTGCAGR ATTCAGTGARTCATCGAAWYTTTGAACGCAYMTTGCRC, wherein: R represents A or G Y represents C or T M represents A or C W represents A or T H represents A or C or T (ii) a portion of SEQ ID NO: 1, provided said nucleic acid binds under stringent conditions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1, or (iii) complementary sequences of (i) and (ii); for the detection of nucleic acids from one or more fungi in a sample.
1 . A method for treating a diseased turfgrass, which comprises applying one or more antifungal agents to the diseased turfgrass, wherein the diseased turfgrass is identified by detecting in a soil or turfgrass sample, by a nucleic acid amplification with at least one nucleic acid primer, the presence of a nucleic acid from a pathogenic fungus in the sample, wherein the primer comprises:
(i)
(SEQ ID NO: 1)
CATCGATGAAGAACGCWGCRAAHTGCGATAMGTARTGYGAATTGCAG
RATTCAGTGARTCATCGAAWYTTTGAACGCAYMTTGCRC,
wherein:
R represents A or G,
Y represents C or T,
M represents A or C,
W represents A or T,
H represents A or C or T,
(ii) a portion of SEQ ID NO: 1, provided said nucleic acid binds under stringent conditions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1, or
(iii) a complementary sequence of (i) or (ii); and
wherein the agent targets the pathogenic fungus in the sample.
2 . The method according to claim 1 , wherein the primer is:
(i)
(SEQ ID NO: 2)
GTGARTCATCGAAWYTTTGAACGCA,
wherein:
R represents A or G,
Y represents C or T,
W represents A or T,
(ii) a portion of SEQ ID NO: 2, provided said nucleic acid binds under stringent conditions to a nucleic acid comprising or consisting of the complementary sequence of SEQ ID NO: 1, or
(iii) a complementary sequence of (i) or (ii).
3 . The method according to claim 1 , wherein the fungus is Ascochyta phleina, Curvularia affinis, Glomerella graminicola, Thanatephorus cucumeris, Pythium ultimum, Gaeumannomyces graminis, Marasmius oreades, Corticium fuciforme, Phytophthora nicotianae. Fusarium culmorum, Bipolaris sorokiniana, Microdochium nivale, Rhizoctonia cerealis, Pythium graminicola, Rhynchosporium secalis, Sclerotinia homoeocarpa, Typhula incarnate, Ustilago striiformis or Septoria macropoda.
4 . The method according to claim 1 , wherein the sample is a soil sample taken from which the turfgrass is grown.
5 . The method according to claim 1 , wherein the sample is a turfgrass sample.
6 . The method according to claim 5 , wherein the turfgrass sample is a root sample.
7 . The method according to claim 1 , wherein the turfgrass is Festaceae, Aveneae, Triticeae, Chlorideae, Zoysieae, Paniceae or Andropogoneae Tribe.
8 . The method according to claim 1 , wherein the nucleic acid amplification is Amplification Fragment Length Polymorphism (AFLP) or Terminal Restriction Fragment Length Polymorphism (T-RFLP).
9 . The method according to claim 1 , wherein the primer is used in association with at least one other primer which targets an 18S rDNA/ITS1 region or an ITS2/28S rDNA region of a fungus.
10 . The method according to claim 9 , wherein the other primer has a nucleic acid sequence of one of SEQ ID NOs: 39 to 42.
11 . The method according to claim 1 , wherein the primer has a nucleic acid sequence selected from one of the following sequences:
(SEQ ID NO: 3)
GTGAATCATCGAAACTTTGAACGCA;
(SEQ ID NO: 4)
GTGAGTCATCGAAACTTTGAACGCA;
(SEQ ID NO: 5)
GTGAATCATCGAATCTTTGAACGCA;
(SEQ ID NO: 6)
GTGAGTCATCGAATCTTTGAACGCA;
(SEQ ID NO: 7)
GTGAATCATCGAAATTTTGAACGCA;
(SEQ ID NO: 8)
GTGAGTCATCGAAATTTTGAACGCA;
(SEQ ID NO: 9)
GTGAATCATCGAATTTTTGAACGCA;
(SEQ ID NO: 10)
GTGAGTCATCGAATTTTTGAACGCA;
(SEQ ID NO: 11)
GTGAATCATCGAAACTTTGAACGCA;
(SEQ ID NO: 12)
GTGAGTCATCGAAACTTTGAACGCA;
(SEQ ID NO: 13)
GTGAATCATCGAATCTTTGAACGCA;
(SEQ ID NO: 14)
GTGAGTCATCGAATCTTTGAACGCA;
(SEQ ID NO: 15)
GTGAATCATCGAAATTTTGAACGCA;
(SEQ ID NO: 16)
GTGAGTCATCGAAATTTTGAACGCA;
(SEQ ID NO: 17)
GTGAATCATCGAATTTTTGAACGCA;
(SEQ ID NO: 18)
GTGAGTCATCGAATTTTTGAACGCA;
or a complementary sequence thereof.
12 . The method according to claim 1 , wherein the primer has a nucleic acid sequence of one of SEQ ID NO: 1 to 38, or a complementary sequence thereof.