Compositions and methods for inhibiting expression of Eg5 gene
View Patent ↗The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of the Eg5 gene (Eg5 gene), comprising an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of the Eg5 gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by Eg5 expression and the expression of the Eg5 gene using the pharmaceutical composition; and methods for inhibiting the expression of the Eg5 gene in a cell.
1. A composition comprising a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of a human kinesin family member 11 (Eg5) gene in a cell, wherein the dsRNA comprises a sense strand comprising a first sequence and an antisense strand comprising a second sequence complementary to 19-24 nucleotides of nucleotides 1066-1101 of NM — 004523 (5′ UUCCUUAUCGAGAAUCUAAACUAACUAGAAUCCUCC 3′ SEQ ID NO:1534), wherein the first sequence is complementary to the second sequence and wherein the dsRNA is between 19 and 30 base pairs in length.
2. The composition of claim 1 , wherein the dsRNA comprises at least one modified nucleotide.
3. The composition of claim 2 , wherein the modified nucleotide is chosen from the group of: a 2′-O-methyl modified nucleotide, a nucleotide comprising a 5′-phosphorothioate group, and a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group.
4. The composition of claim 2 , wherein the modified nucleotide is chosen from the group of: a 2′-deoxy-2′-fluoro modified nucleotide, a 2′-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, 2′-amino-modified nucleotide, 2′-alkyl-modified nucleotide, morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide.
5. The composition of claim 2 , wherein the dsRNA comprises at least one 2′-O-methyl modified ribonucleotide and at least one phosphorothioate.
6. The composition of claim 1 , wherein the composition, upon contact with a cell expressing Eg5, inhibits expression of Eg5 gene by at least 40%.
7. The composition of claim 1 , wherein the dsRNA is 19-21 base pairs in length.
8. An isolated cell comprising the composition of claim 1 .
9. A vector comprising a regulatory sequence operably linked to a nucleotide sequence that encodes at least one strand of the dsRNA of the composition of claim 1 .
10. An isolated cell comprising the vector of claim 9 .
11. A pharmaceutical composition for inhibiting Eg5 gene expression comprising the composition of claim 1 and a pharmaceutically acceptable carrier.
12. A method for inhibiting Eg5 gene expression in a cell, the method comprising:
introducing into the cell the composition of claim 1 ; and
maintaining the cell for a time sufficient to obtain degradation of the mRNA transcript of the Eg5 gene, thereby inhibiting expression of the Eg5 gene in the cell.
13. A method of treating or managing pathological processes mediated by human Eg5 expression comprising administering to a patient in need of such treatment or management a therapeutically effective amount of the composition of claim 1 .
14. The composition of claim 1 , wherein the second sequence is complementary to 19 nucleotides of SEQ ID NO: 1246, 1247, 1257, 1260, or 1265.
15. The composition of claim 1 , wherein the sense strand consists of the nucleotide sequence of SEQ ID NO:5 and the antisense strand consist of the nucleotide sequence of SEQ ID NO:6 or the sense strand consists of the nucleotide sequence of SEQ ID NO:7 and the antisense strand consist of the nucleotide sequence of SEQ ID NO:8 or the sense strand consists of the nucleotide sequence of SEQ ID NO:27 and the antisense strand consist of the nucleotide sequence of SEQ ID NO:28 or the sense strand consists of the nucleotide sequence of SEQ ID NO:33 and the antisense strand consist of the nucleotide sequence of SEQ ID NO:34 or the sense strand consists of the nucleotide sequence of SEQ ID NO:43 and the antisense strand consist of the nucleotide sequence of SEQ ID NO:44.
16. The composition of claim 15 , wherein each strand is modified as follows to include a 2′-O-methyl ribonucleotide as indicated by a lower case letter “c” or “u” and a phosphorothioate as indicated by a lower case letter “s:”
SEQ ID No:
(sense sequence 5′-3′)
SEQ ID No:
antisense sequence (5′-3′)
5
ucuAAAcuAAcuAGAAuccTsT
6
GGAUUCuAGUuAGUUuAGATsT
7
cuuAucGAGAAucuAAAcuTsT
8
AGUUuAGAUUCUCGAuAAGTsT
27
ccuuAucGAGAAucuAAAcTsT
28
GUUuAGAUUCUCGAuAAGGTsT
33
AucuAAAcuAAcuAGAAucTsT
34
GAUUCuAGUuAGUUuAGAUTsT
43
cuAAAcuAAcuAGAAuccuTsT
44
AGGAUUCuAGUuAGUUuAGTsT.
17. A pharmaceutical composition for inhibiting Eg5 gene expression comprising the composition of claim 15 and a pharmaceutically acceptable carrier.
18. A method for inhibiting Eg5 gene expression in a cell, the method comprising:
introducing into the cell the composition of claim 15 ; and
maintaining the cell for a time sufficient to obtain degradation of the mRNA transcript of the Eg5 gene, thereby inhibiting expression of the Eg5 gene in the cell.
19. A method of treating pathological processes mediated by human Eg5 expression comprising administering to a patient a therapeutically effective amount of the composition of claim 15 .
20. A pharmaceutical composition for inhibiting Eg5 gene expression comprising the composition of claim 16 and a pharmaceutically acceptable carrier.
21. A method for inhibiting Eg5 gene expression in a cell, the method comprising:
introducing into the cell the composition of claim 16 ; and
maintaining the cell for a time sufficient to obtain degradation of the mRNA transcript of the Eg5 gene, thereby inhibiting expression of the Eg5 gene in the cell.
22. A method of treating pathological processes mediated by human Eg5 expression comprising administering to a patient a therapeutically effective amount of the composition of claim 16 .
23. The composition of claim 1 , wherein the sense strand consists of the nucleotide sequence of SEQ ID NO:5 and the antisense strand consist of the nucleotide sequence of SEQ ID NO:6.
24. The composition of claim 1 , wherein the sense strand consists of the nucleotide sequence of SEQ ID NO:7 and the antisense strand consist of the nucleotide sequence of SEQ ID NO:8.
25. The composition of claim 1 , wherein the sense strand consists of the nucleotide sequence of SEQ ID NO:27 and the antisense strand consist of the nucleotide sequence of SEQ ID NO:28.
26. The composition of claim 1 , wherein the sense strand consists of the nucleotide sequence of SEQ ID NO:33 and the antisense strand consist of the nucleotide sequence of SEQ ID NO:34.
27. The composition of claim 1 , wherein the sense strand consists of the nucleotide sequence of SEQ ID NO:43 and the antisense strand consist of the nucleotide sequence of SEQ ID NO:44.