METHODS AND MEANS FOR EFFICIENT SKIPPING OF EXON 45 IN DUCHENNE MUSCULAR DYSTROPHY PRE-mRNA
The invention relates to a method for inducing or promoting skipping of exon 45 of DMD pre-mRNA in a Duchenne Muscular Dystrophy patient, preferably in an isolated (muscle) cell, the method comprising providing an isolate muscle cell with a molecule that binds to a continuous stretch of at least 21 nucleotides within said exon. The invention further relates to such molecule used in the method.
1 . An isolated antisense oligonucleotide consisting of 22, 23, 24, 25, 26, 27, 28 or 29 nucleotides, wherein said oligonucleotide is complementary along its entire length to a sequence in part of the human dystrophin exon 45 pre-mRNA, wherein said sequence is complementary to at least 22 nucleotides of a sequence consisting of 5′-UUUGCCGCUGCCCAAUGCCAUCCUG-3′ (SEQ ID NO: 3).
2 . A viral-based vector comprising an expression cassette comprising a nucleotide sequence encoding the oligonucleotide of claim 1 .
3 . A pharmaceutical composition comprising the oligonucleotide of claim 1 , and a pharmaceutically acceptable carrier.
4 . The oligonucleotide of claim 1 , wherein said oligonucleotide comprises a phosphorothioate internucleoside linkage and a 2′-O-alkyl substituted ribose moiety.
5 . The oligonucleotide of claim 1 , wherein said oligonucleotide induces skipping of exon 45.
6 . The oligonucleotide of claim 1 , wherein the oligonucleotide comprises a nucleotide analogue, wherein the nucleotide analogue comprises a modified base, and/or a modified sugar moiety, and/or a modified internucleoside linkage.
7 . The oligonucleotide of claim 6 , wherein the nucleotide analogue comprises a modified base.
8 . The oligonucleotide of claim 1 , comprising a modified backbone.
9 . The oligonucleotide of claim 6 , wherein the modified sugar moiety is a ribose that is mono- or di-substituted at the 2′, 3′, and/or 5′ position.
10 . The oligonucleotide of claim 9 , wherein the ribose is a 2′-O-substituted ribose.
11 . The oligonucleotide of claim 10 , wherein the ribose is a 2′-O methyl ribose.
12 . The oligonucleotide of claim 6 , wherein each sugar moiety of the oligonucleotide comprises a 2′-O-methyl substitution and each internucleoside linkage of said oligonucleotide comprises a phosphorothioate moiety.
13 . An isolated antisense oligonucleotide consisting of 22, 23, 24, 25, 26, 27, 28, or 29 nucleotides, wherein said oligonucleotide is complementary along its entire length to a sequence in part of the human dystrophin exon 45 pre-mRNA, wherein said sequence is complementary to at least 22 nucleotides of a sequence consisting of 5′UUUGCCGCUGCCCAAUGCCAUCCUG 3′ (SEQ ID NO:3); wherein each sugar moiety of the oligonucleotide is 2′-O-methyl substituted and each of the internucleoside linkages present in the oligonucleotide comprises a phosphorothioate moiety.
14 . The oligonucleotide of claim 8 , wherein the modified backbone is selected from the group consisting of a morpholino backbone, a carbamate backbone, a siloxane backbone, a sulfide backbone, a sulfoxide backbone, a sulfone backbone, a formacetyl backbone, a thioformacetyl backbone, a methyleneformacetyl backbone, a riboacetyl backbone, an alkene containing backbone, a sulfamate backbone, a sulfonate backbone, a sulfonamide backbone, a methyleneimino backbone, a methylenehydrazino backbone and an amide backbone.
15 . The oligonucleotide of claim 1 , wherein the oligonucleotide comprises a phosphorodiamidate morpholino oligomer (PMO), peptide nucleic acid, and/or locked nucleic acid.
16 . The pharmaceutical composition of claim 3 , further comprising a molecule which induces or promotes skipping of exon 7, 44, 46, 51, 53, 59, or 67 of dystrophin pre-mRNA of a patient.
17 . A pharmaceutical composition comprising the antisense oligonucleotide of claim 13 and a pharmaceutically acceptable carrier.
18 . The oligonucleotide of claim 1 , wherein the oligonucleotide consists of 22, 23, 24, or 25 nucleotides.
19 . The oligonucleotide of claim 1 , wherein the oligonucleotide consists of 25, 26, 27, 28, or 29 nucleotides.
20 . The oligonucleotide of claim 1 , wherein the oligonucleotide consists of 25 nucleotides.
21 . The oligonucleotide of claim 1 , wherein the nucleotides of said oligonucleotide comprise purine and pyrimidine bases.
22 . The oligonucleotide of claim 21 , wherein the bases are selected from the group consisting of: adenine, cytosine, guanine, thymine and uracil.
23 . The oligonucleotide of claim 13 , wherein the oligonucleotide consists of 22, 23, 24, or 25 nucleotides.
24 . The oligonucleotide of claim 13 , wherein the oligonucleotide consists of 25, 26, 27, 28, or 29 nucleotides.
25 . The oligonucleotide of claim 13 , wherein the oligonucleotide consists of 25 nucleotides.
26 . The oligonucleotide of claim 13 , wherein the nucleotides of said oligonucleotide comprise purine and pyrimidine bases.
27 . The oligonucleotide of claim 26 , wherein the bases are selected from the group consisting of: adenine, cytosine, guanine, thymine and uracil.
28 . The oligonucleotide of claim 19 , wherein the oligonucleotide comprises the base sequence of 5′-UUUGCCGCUGCCCAAUGCCAUCCUG-3′ (SEQ ID: NO: 3).
29 . The oligonucleotide of claim 24 , wherein the oligonucleotide comprises the base sequence of 5′-UUUGCCGCUGCCCAAUGCCAUCCUG-3′ (SEQ ID: NO: 3).
30 . The oligonucleotide of claim 5 , wherein the oligonucleotide induces exon 45 skipping with an efficiency of at least 50%.
31 . An oligomer for ameliorating DMD, the oligomer consisting of 22, 23, 24, 25, 26, 27, 28, or 29 nucleotides, comprising at least 22 nucleotides of the base sequence of 5′-UUUGCCGCUGCCCAAUGCCAUCCUG-3′ (SEQ ID: NO: 3); wherein the bases of the oligomer are selected from the group consisting of: adenine, cytosine, guanine, thymine and uracil; and wherein the molecule can bind to a target site to cause exon skipping in an exon of the dystrophin gene.
32 . The oligomer of claim 31 , wherein the oligomer consists of 22, 23, 24, or 25 nucleotides.
33 . The oligomer of claim 31 , wherein the oligomer consists of 25, 26, 27, 28, or 29 nucleotides.
34 . The oligomer of claim 31 , wherein the oligomer consists of 25 nucleotides.
35 . An oligomer for alleviating DMD, the oligomer consisting of 25 nucleotides, and consisting of the sequence 5′-UUUGCCGCUGCCCAAUGCCAUCCUG-3′ (SEQ ID: NO: 3); wherein the molecule can bind to a target site to cause exon skipping in an exon of the dystrophin gene.
36 . An isolated antisense oligomer whose base sequence consists of the base sequence of 5′-UUUGCCGCUGCCCAAUGCCAUCCUG-3′ (SEQ ID: NO: 3).
37 . An isolated antisense oligomer consisting of 22, 23, 24, 25, 26, 27, 28, or 29 nucleotides comprising at least 22 nucleotides of the base sequence of 5′-UUUGCCGCUGCCCAAUGCCAUCCUG-3′ (SEQ ID: NO: 3).
38 . The oligomer of claim 37 , wherein the oligonucleotide consists of 22, 23, 24, or 25 nucleotides.
39 . The oligomer of claim 37 , wherein the oligonucleotide consists of 25, 26, 27, 28, or 29 nucleotides.
40 . The oligomer of claim 37 , wherein the oligomer consists of 25 nucleotides.
41 . The oligonucleotide of claim 30 , wherein, efficiency of exon skipping is determined using RT-PCR or sequence analysis.
42 . The oligonucleotide of claim 6 , wherein the nucleotide analogue comprises a modified internucleoside linkage.
43 . The oligonucleotide of claim 42 , wherein the modified internucleoside linkage is a phosphorothioate moiety.
44 . An isolated antisense oligonucleotide consisting of 22, 23, 24, 25, 26, 27, 28, or 29 nucleotides, wherein said oligonucleotide is complementary to at least 22 nucleotides of a sequence consisting of 5′UUUGCCGCUGCCCAAUGCCAUCCUG 3′ (SEQ ID NO:3).
45 . An isolated antisense oligonucleotide, consisting of 22, 23, 24, 25, 26, 27, 28 or 29 nucleotides, wherein said oligonucleotide is complementary to at least 22 nucleotides of a sequence consisting of 5′ UUUGCCGCUGCCCAAUGCCAUCCUG 3′ (SEQ ID NO:3); wherein said oligonucleotide comprises at least one 2′-O-methyl substituted sugar moiety and at least one internucleoside linkage.
46 . The oligonucleotide of claim 45 , wherein each substituted sugar moiety of the oligonucleotide is 2′-O-methyl substituted.
47 . The oligonucleotide of claim 45 , wherein each internucleoside linkage of the oligonucleotide is a phosporothioate linkage.