Exon skipping compositions for treating muscular dystrophy
View Patent ↗Antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon 44 skipping are described.
1. An antisense oligonucleotide of 28 bases comprising the base sequence GAAACTGTTCAGCTTCTGTTAGCCACTG (SEQ ID NO: 6), wherein the antisense oligonucleotide is a morpholino antisense oligonucleotide.
2. The antisense oligonucleotide of claim 1 , wherein the antisense oligonucleotide is chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the antisense oligonucleotide.
3. The antisense oligonucleotide of claim 1 , wherein the oligonucleotide is chemically linked to a polyethylene glycol moiety.
4. A pharmaceutical composition comprising an antisense oligonucleotide of 28 bases comprising the base sequence GAAACTGTTCAGCTTCTGTTAGCCACTG (SEQ ID NO: 6), wherein the antisense oligonucleotide is a morpholino antisense oligonucleotide, and a pharmaceutically acceptable carrier.
5. The pharmaceutical composition of claim 4 , wherein the antisense oligonucleotide is chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the antisense oligonucleotide.
6. The pharmaceutical composition of claim 4 , wherein the oligonucleotide is chemically linked to a polyethylene glycol moiety.