RNA-guided human genome engineering
A method of altering a eukaryotic cell is provided including transfecting the eukaryotic cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell, transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.
1. A method of modulating expression of a target nucleic acid in a eukaryotic cell comprising
providing to the cell a guide RNA sequence complementary to the target nucleic acid sequence,
providing to the cell a Cas9 protein having inactive nuclease domains that interacts with the guide RNA sequence and binds to the target nucleic acid sequence in a site specific manner,
wherein the Cas9 protein having inactive nuclease domains includes a transcriptional activator or repressor domain attached thereto for modulating target nucleic acid expression in vivo,
wherein the guide RNA sequence and the Cas9 protein including the transcriptional activator or repressor domain co-localize to the target nucleic acid sequence and wherein the transcriptional activator or repressor domain modulates expression of the target nucleic acid,
wherein the guide RNA sequence includes a guide sequence complementary to the target nucleic acid sequence and a gRNA scaffold sequence having the following nucleic acid sequence GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGC (SEQ ID NO:46).
2. The method of claim 1
wherein the guide RNA sequence is provided to the cell by introducing to the cell a nucleic acid encoding the guide RNA sequence,
wherein the Cas9 protein including the transcriptional activator or repressor domain is provided to the cell by introducing to the cell a nucleic acid encoding the Cas9 protein including the transcriptional activator or repressor domain, and
wherein the cell expresses the guide RNA sequence and the Cas9 protein including the transcriptional activator or repressor domain.
3. The method of claim 1 wherein the eukaryotic cell is a yeast cell, a plant cell or a mammalian cell.
4. The method of claim 1 wherein the eukaryotic cell is a human cell.
5. The method of claim 1 wherein the Cas 9 protein is encoded by a human codon optimized nucleic acid sequence.
6. The method of claim 1 wherein the Cas 9 protein includes a nuclear localization signal.
7. The method of claim 1 wherein the eukaryotic cell is a stem cell.
8. The method of claim 1 wherein the eukaryotic cell is a human stem cell.
9. The method of claim 1 wherein the eukaryotic cell is an induced pluripotent stem cell.
10. The method of claim 1 wherein the eukaryotic cell is a human induced pluripotent stem cell.