IP Library › Patent Application 14441081
Patent Application
App. No. 14/441,081

METHODS AND COMPOSITIONS FOR THE DIAGNOSIS OF MULTIPLE SCLEROSIS

Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US None
App. No.
14/441,081
Abstract

Disclosed herein are methods and compositions for diagnosing multiple sclerosis (“MS”) in a subject or the risk of MS in a subject. More particularly, methods and compositions for the use of genetic markers for diagnosing MS in subject or the risk of MS in a subject.

Claims (24)

1 . A method of determining the risk of multiple sclerosis (MS), the method comprising:

assaying a biological sample of a subject for the presence of at least one variant allele listed in Table 1 and Table 2;

wherein the presence of the at least one variant allele is indicative of a risk of MS.

2 . The method of claim 1 , wherein the sample is assayed for the presence of at least one variant allele listed in Table 1 and Table 2 with at least one assay selected from a PCR assay, SNP array, PCR-based SNP genotyping, DNA hybridization, fluorescence microscopy, and immunoassay.

3 . The method of claim 1 , wherein the sample is assayed for the presence of at least one variant allele listed in Table 1 and Table 2 with a PCR assay using one or more of the PCR primer sequences selected from SEQ ID NOS: 1-156.

4 . The method of claim 1 , wherein the sample is assayed for the presence of at least one variant allele listed in Table 1 with a PCR assay using one or more of the PCR primer sequences selected from SEQ ID NOS: 1-6.

5 . The method of claim 1 , wherein the sample is assayed for the presence of at least one variant allele listed in Table 1 by assaying the sample for the presence of at least one of the chromosome 16 variant allele of Table 1, in the gene ELMO3, at position chr16:67236368, using the forward primer ACTCCAGGCTCTGAGACAGC (SEQ ID NO: 1) and the reverse primer CACCTTGTCGAAGTCCTCCT (SEQ ID NO: 2), wherein the variant allele is A; the chromosome 16 variant allele of Table 1, in the gene ZFHX3 (ATBF1), at position chr16:72993489, using the forward primer TATTCGGGAAAGCCTGGTCT (SEQ ID NO: 3) and the reverse primer CCTCGCTTTTCCTGAACTCT (SEQ ID NO: 4), wherein the variant allele is C; and the chromosome 16 variant allele of Table 1, in the gene IL34, at position chr16:70690511, using the forward primer GGAGCCTGCTGGTCATTTCT (SEQ ID NO: 5) and the reverse primer CAGGAAGGGATTCTCACCAG (SEQ ID NO: 6), wherein the variant allele is C.

6 . The method of claim 5 , wherein the sample is assayed for the presence of both the chromosome 16 variant allele of Table 1, in the gene ELMO3, at position chr16:67236368, using the forward primer ACTCCAGGCTCTGAGACAGC (SEQ ID NO: 1) and the reverse primer CACCTTGTCGAAGTCCTCCT (SEQ ID NO: 2), wherein the variant allele is A; and the chromosome 16 variant allele of Table 1, in the gene ZFHX3 (ATBF1), at position chr16:72993489, using the forward primer TATTCGGGAAAGCCTGGTCT (SEQ ID NO: 3) and the reverse primer CCTCGCTTTTCCTGAACTCT (SEQ ID NO: 4), wherein the variant allele is C.

7 . The method of claim 5 , wherein the sample is assayed for the presence of both the chromosome 16 variant allele of Table 1, in the gene ELMO3, at position chr16:67236368, using the forward primer ACTCCAGGCTCTGAGACAGC (SEQ ID NO: 1) and the reverse primer CACCTTGTCGAAGTCCTCCT (SEQ ID NO: 2), wherein the variant allele is A; and the chromosome 16 variant allele of Table 1, in the gene IL34, at position chr16:70690511, using the forward primer GGAGCCTGCTGGTCATTTCT (SEQ ID NO: 5) and the reverse primer CAGGAAGGGATTCTCACCAG (SEQ ID NO: 6), wherein the variant allele is C.

8 . The method of claim 5 , wherein the sample is assayed for the presence of both the chromosome 16 variant allele of Table 1, in the gene ZFHX3 (ATBF1), at position chr16:72993489, using the forward primer TATTCGGGAAAGCCTGGTCT (SEQ ID NO: 3) and the reverse primer CCTCGCTTTTCCTGAACTCT (SEQ ID NO: 4), wherein the variant allele is C; and the chromosome 16 variant allele of Table 1, in the gene IL34, at position chr16:70690511, using the forward primer GGAGCCTGCTGGTCATTTCT (SEQ ID NO: 5) and the reverse primer CAGGAAGGGATTCTCACCAG (SEQ ID NO: 6), wherein the variant allele is C.

9 . The method of claim 1 , wherein the sample is assayed for the presence of at least one variant allele listed in Table 2 with a PCR assay using one or more of the forward and reverse primers sequences selected from SEQ ID NOS: 7-156.

10 . The method of claim 1 , wherein the presence of the at least one variant allele indicates a diagnosis of MS in the subject.

11 . An in vitro diagnostic product for detecting the risk of MS in a subject, the product comprising:

at least one laboratory test for assaying a biological sample of a subject for the presence of at least one variant allele listed in Table 1 and Table 2

wherein the presence of the at least one variant allele is indicative of a risk of MS.

12 . The in vitro diagnostic product of claim 11 , wherein the sample is assayed for the presence of at least one variant allele listed in Table 1 and Table 2 with at least one assay selected from a PCR assay, SNP array, PCR-based SNP genotyping, DNA hybridization, fluorescence microscopy, and immunoassay.

13 . The in vitro diagnostic product of claim 11 , wherein the sample is assayed for the presence of at least one variant allele listed in Table 1 and Table 2 with a PCR assay using one or more of the PCR primer sequences selected from SEQ ID NOS: 1-156.

14 . The in vitro diagnostic product of claim 11 , wherein the sample is assayed for the presence of at least one variant allele listed in Table 1 with a PCR assay using one or more of the PCR primer sequences selected from SEQ ID NOS: 1-6.

15 . The in vitro diagnostic product of claim 11 , wherein the sample is assayed for the presence of at least one variant allele listed in Table 1 by assaying the sample for the presence of at least one of the chromosome 16 variant allele of Table 1, in the gene ELMO3, at position chr16:67236368, using the forward primer ACTCCAGGCTCTGAGACAGC (SEQ ID NO: 1) and the reverse primer CACCTTGTCGAAGTCCTCCT (SEQ ID NO: 2), wherein the variant allele is A; the chromosome 16 variant allele of Table 1, in the gene ZFHX3 (ATBF1), at position chr16:72993489, using the forward primer TATTCGGGAAAGCCTGGTCT (SEQ ID NO: 3) and the reverse primer CCTCGCTTTTCCTGAACTCT (SEQ ID NO: 4), wherein the variant allele is C; and the chromosome 16 variant allele of Table 1, in the gene IL34, at position chr16:70690511, using the forward primer GGAGCCTGCTGGTCATTTCT (SEQ ID NO: 5) and the reverse primer CAGGAAGGGATTCTCACCAG (SEQ ID NO: 6), wherein the variant allele is C.

16 . The in vitro diagnostic product of claim 15 , wherein the sample is assayed for the presence of both the chromosome 16 variant allele of Table 1, in the gene ELMO3, at position chr16:67236368, using the forward primer ACTCCAGGCTCTGAGACAGC (SEQ ID NO: 1) and the reverse primer CACCTTGTCGAAGTCCTCCT (SEQ ID NO: 2), wherein the variant allele is A; and the chromosome 16 variant allele of Table 1, in the gene ZFHX3 (ATBF1), at position chr16:72993489, using the forward primer TATTCGGGAAAGCCTGGTCT (SEQ ID NO: 3) and the reverse primer CCTCGCTTTTCCTGAACTCT (SEQ ID NO: 4), wherein the variant allele is C.

17 . The in vitro diagnostic product of claim 15 , wherein the sample is assayed for the presence of both the chromosome 16 variant allele of Table 1, in the gene ELMO3, at position chr16:67236368, using the forward primer ACTCCAGGCTCTGAGACAGC (SEQ ID NO: 1) and the reverse primer CACCTTGTCGAAGTCCTCCT (SEQ ID NO: 2), wherein the variant allele is A; and the chromosome 16 variant allele of Table 1, in the gene IL34, at position chr16:70690511, using the forward primer GGAGCCTGCTGGTCATTTCT (SEQ ID NO: 5) and the reverse primer CAGGAAGGGATTCTCACCAG (SEQ ID NO: 6), wherein the variant allele is C.

18 . The in vitro diagnostic product of claim 15 , wherein the sample is assayed for the presence of both the chromosome 16 variant allele of Table 1, in the gene ZFHX3 (ATBF1), at position chr16:72993489, using the forward primer TATTCGGGAAAGCCTGGTCT (SEQ ID NO: 3) and the reverse primer CCTCGCTTTTCCTGAACTCT (SEQ ID NO: 4), wherein the variant allele is C; and the chromosome 16 variant allele of Table 1, in the gene IL34, at position chr16:70690511, using the forward primer GGAGCCTGCTGGTCATTTCT (SEQ ID NO: 5) and the reverse primer CAGGAAGGGATTCTCACCAG (SEQ ID NO: 6), wherein the variant allele is C.

19 . The in vitro diagnostic product of claim 15 , wherein the sample is assayed for the presence of at least one variant allele listed in Table 2 with a PCR assay using one or more of the forward and reverse primers sequences selected from SEQ ID NOS: 7-156.

20 . The in vitro diagnostic product of claim 11 , wherein the presence of the at least one variant allele indicates a diagnosis of MS in the subject.

Assignments (1)
SECURITY INTEREST Recorded Oct 4, 2017
From: LINEAGEN, INC.
To: SILICON VALLEY BANK
Reel/Frame 043784/0354 →