Universal sanger sequencing from next-gen sequencing amplicons
Described herein are methods, compositions and kits directed to amplification of nucleic acids suitable for both next generation sequencing (NGS) and a second round of sequencing as validation, such as Sanger sequencing.
1. A composition comprising:
a first oligonucleotide that comprises, in 5′ to 3′ order,
(a) a first region suitable for use as a Sanger sequencing primer;
(b) a spacer that is between about 5 and about 15 nucleotides long; and
(c) a third region suitable for use as a next generation sequencing (NGS) primer, and
a second oligonucleotide that comprises, in 5′ to 3′ order,
(a) a first region that is substantially identical to the third region of the first oligonucleotide; and
(b) a second region that is suitable for use as a polymerase chain reaction (PCR) primer to amplify a target nucleotide sequence,
wherein the third region of the first oligonucleotide and the first region of the second oligonucleotide have a melting temperature (T m ) that is at least about 5° C. higher than the T m of the second region of the second oligonucleotide,
wherein the total length of the spacer and the first and second regions of the second oligonucleotide is at least about 45 nucleotides (nt) long,
wherein the third region of the first oligonucleotide and the first region of the second oligonucleotide are selected from Table 2, and
wherein the third region of the first oligonucleotide and the first region of the second oligonucleotide do not include any sequence that is specific to the target nucleotide sequence.
2. The composition of claim 1 , wherein the first oligonucleotide is not longer than about 100 nt.
3. The composition of claim 1 , wherein the second oligonucleotide is not longer than about 60 nt.
4. The composition of claim 1 , wherein the T m of the third region of the first oligonucleotide and the first region of the second oligonucleotide is between about 65° C. and about 75° C.
5. The composition of claim 1 , wherein the T m of the second region of the second oligonucleotide is between about 55° C. and about 65° C.
6. The composition of claim 1 , wherein the first region of the first oligonucleotide is selected from Table 1.
7. The composition of claim 1 , further comprising:
a third oligonucleotide that comprises, in 5′ to 3′ order,
(a) a first region suitable for use as a Sanger sequencing primer;
(b) a spacer that is between about 5 and about 15 nucleotides long; and
(c) a third region suitable for use as a next generation sequencing (NGS) primer, and
a fourth oligonucleotide that comprises, in 5′ to 3′ order,
(a) a first region that is substantially identical to the third region of the third oligonucleotide; and
(b) a second region that is suitable for use as a polymerase chain reaction (PCR) primer,
wherein the third region of the third oligonucleotide and the first region of the fourth oligonucleotide have a melting temperature (T m ) that is at least about 5° C. higher than the T m of the second region of the fourth oligonucleotide,
wherein the total length of the spacer of the third oligonucleotide and the first and second regions of the fourth oligonucleotide is at least about 45 nucleotides (nt) long, and
wherein the first region of the first oligonucleotide is substantially different from the first region of the third oligonucleotide and the first region of the second oligonucleotide is substantially different from the first region of the fourth oligonucleotide.
8. The composition of claim 7 , wherein the second region of the second oligonucleotide and the second region of the fourth oligonucleotide are suitable for amplifying a human genomic sequence.
9. An oligonucleotide comprising, in 5′ to 3′ order:
(a) a first region selected from the nucleic acid sequences of Table 1;
(b) a spacer that is between about 5 and about 15 nucleotides long; and
(c) a third region selected from the nucleic acid sequences of Table 2.
10. The oligonucleotide of claim 9 , comprising a sequence of
(SEQ ID NO: 9)
GTAAAACGACGGCCAGTATTTAGGTGACACTATAGACACTGACGACATGG
TTCTACA
or
(SEQ ID NO: 10)
AACAGCTATGACCATGCAGTCAAGTAACAACCGCGATACGGTAGCAGAGA
CTTGGTCT.
11. A method for amplifying a nucleotide sequence, comprising:
(i) incubating a target nucleotide template with a first and third oligonucleotides each comprising, in 5′ to 3′ order,
(a) a first region suitable for use as a Sanger sequencing primer;
(b) a spacer that is between about 5 and about 15 nucleotides long; and
(c) a third region suitable for use as a next generation sequencing (NGS) primer, and
a second and fourth oligonucleotides comprising, in 5′ to 3′ order,
(d) first regions that are substantially identical to the third region of the first or third oligonucleotide, respectively; and
(e) second regions which, in combination, suitable for amplifying the target nucleotide template as a pair of polymerase chain reaction (PCR) primers,
wherein the third regions of the first and third oligonucleotides and the first regions of the second and fourth oligonucleotides have a melting temperature (T m ) that is at least about 5° C. higher than the T m of the second regions of the second and fourth oligonucleotide, and
wherein the total length of the spacer of the first oligonucleotide and the first and second regions of the second oligonucleotide is at least about 45 nucleotides (nt) long and the total length of the spacer of the third oligonucleotide and the first and second regions of the fourth oligonucleotide is at least about 45 nucleotides (nt) long, and
wherein the first region of the first oligonucleotide is substantially different from the first region of the third oligonucleotide and the first region of the second oligonucleotide is substantially different from the first region of the fourth oligonucleotide;
(ii) performing a plurality of PCR cycles with a first annealing temperature (T a ) suitable for amplification using the second regions of the second and fourth oligonucleotides as primers; and
(iii) performing a plurality of PCR cycles with a second annealing temperature (T a ) suitable for amplification using the third regions of the first and third oligonucleotides as primers.
12. The method of claim 11 , wherein the first regions of the first and third oligonucleotides are selected from Table 1.
13. The method of claim 11 , wherein the first regions of the third and fourth oligonucleotides are selected from Table 2.
14. The method of claim 11 , wherein the first Ta is between about 53° C. and about 57° C.
15. The method of claim 11 , wherein the second Ta is between about 59° C. and about 63° C.
16. The method of claim 11 , wherein the ratios of concentrations of the first oligonucleotide to the second oligonucleotide and the third oligonucleotide to the fourth oligonucleotide are less than about 1:1.
17. A composition or kit, comprising a first and second oligonucleotides each comprising, in 5′ to 3′ order,
(a) a first region suitable for use as a Sanger sequencing primer;
(b) a spacer that is between about 5 and about 15 nucleotides long; and
(c) a third region suitable for use as a next generation sequencing (NGS) primer,
wherein the first regions of the first and second oligonucleotides are substantially different and the third regions of the first and second oligonucleotides are substantially different, and wherein the third regions of the first and second oligonucleotides are selected from Table 2.
18. The composition or kit of claim 17 , wherein the first regions of the first and second oligonucleotides are selected from Table 1.