Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.
1. A method of modulating transcription from a target DNA molecule, the method comprising:
contacting a target DNA molecule inside of a cell with a complex comprising:
(a) a chimeric Cas9 protein comprising a Cas9 polypeptide fused to a heterologous polypeptide, wherein the Cas9 polypeptide comprises one or more mutations in a RuvC domain and/or a HNH domain; and
(b) a DNA-targeting RNA comprising:
(i) a targeter-RNA that hybridizes with a target sequence of the target DNA molecule, and
(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,
thereby resulting in modulation of transcription from the target DNA molecule.
2. The method of claim 1 , wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 10 base pairs.
3. The method of claim 1 , wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 10 to 15 base pairs.
4. The method of claim 1 , wherein said contacting comprises introducing into the cell one or more of:
(1) the chimeric Cas9 protein, or a nucleic acid encoding the chimeric Cas9 protein;
(2) the targeter-RNA, or a DNA molecule encoding the targeter-RNA; and
(3) the activator-RNA, or a DNA molecule encoding the activator-RNA.
5. The method of claim 4 , wherein one or more of:
the nucleic acid encoding the chimeric Cas9 protein;
the DNA molecule encoding the targeter-RNA; and
the DNA molecule encoding the activator-RNA,
is a recombinant expression vector selected from the group consisting of: a plasmid, a cosmid, a minicircle, a phage, and a viral vector.
6. The method of claim 4 , wherein said contacting comprises introducing (1), (2), and (3) into the cell.
7. The method of claim 4 , wherein said contacting comprises introducing the targeter-RNA and the activator-RNA into the cell.
8. The method of claim 4 , wherein said contacting comprises introducing the chimeric Cas9 protein, the targeter-RNA, and the activator-RNA into the cell.
9. The method of claim 4 , wherein the DNA molecule encoding the targeter-RNA and the DNA molecule encoding the activator-RNA are the same DNA molecule.
10. The method of claim 4 , wherein one or more of:
the targeter-RNA,
the DNA molecule encoding the targeter-RNA,
the targeter-RNA, and
the DNA molecule encoding the targeter-RNA,
is conjugated to a heterologous moiety.
11. The method of claim 10 , wherein the heterologous moiety is one or more of: an intercalator, a reporter molecule, a polyamine, a polyamide, a polyethylene glycol, a polyether, a cholesterol, a lipid, a cholic acid, a thioether, a thiocholesterol, an aliphatic chain, a phospholipid, an adamantane acetic acid, a palmityl moiety, an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety, a biotin, a phenazine, a folate, a phenanthridine, an anthraquinone, an acridine, a fluorescein, a rhodamine, a fluor, a coumarin, a dye, and a protein transduction domain.
12. The method of claim 1 , wherein said contacting comprises inducing the expression of (a).
13. The method of claim 1 , wherein the method comprises introducing two or more DNA-targeting RNAs into the cell, wherein the two or more DNA-targeting RNAs hybridize with different target sequences within the same or different target DNA molecules.
14. The method of claim 1 , wherein the target sequence is 15 nucleotides (nt) to 18 nt long.
15. The method of claim 1 , wherein the target sequence is 18 nucleotides (nt) to 25 nt long.
16. The method of claim 1 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441).
17. The method of claim 1 , wherein the activator-RNA comprises the 67 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGU CGGUGCUUUUUUU (SEQ ID NO: 432).
18. The method of claim 1 , wherein the targeter-RNA and the activator-RNA are not covalently linked by intervening nucleotides.
19. The method of claim 1 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.
20. The method of claim 1 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: a phosphorothioate, an inverted polarity linkage, an abasic nucleoside linkage, a locked nucleic acid (LNA), a 2′-O-methoxyethyl modified sugar moiety, a 2′-O-methyl modified sugar moiety, a 2′-O-(2-methoxyethyl) modified sugar moiety, a 2′-fluoro modified sugar moiety, a 2′-dimethylaminooxyethoxy modified sugar moiety, a 2′-dimethylaminoethoxyethoxy modified sugar moiety, a peptide nucleic acid (PNA), a morpholino nucleic acid, and a cyclohexenyl nucleic acid (CeNA).
21. The method of claim 1 , wherein the targeter-RNA and the activator-RNA are conjugated to a heterologous moiety.
22. The method of claim 1 , wherein the targeter-RNA and/or the activator-RNA is conjugated to one or more of: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioether; a thiocholesterol; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine moiety; a hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a dye; and a coumarin.
23. The method of claim 1 , wherein the targeter-RNA and/or the activator-RNA comprises one or more nucleobases that comprise one or more of: a 5-methylcytosine; a 5-hydroxymethyl cytosine; a xanthine; a hypoxanthine; a 2-aminoadenine; a 6-methyl derivative of adenine; a 6-methyl derivative of guanine; a 2-propyl derivative of adenine; a 2-propyl derivative of guanine; a 2-thiouracil; a 2-thiothymine; a 2-thiocytosine; a 5-propynyl uracil; a 5-propynyl cytosine; a 6-azo uracil; a 6-azo cytosine; a 6-azo thymine; a pseudouracil; a 4-thiouracil; an 8-haloadenin; an 8-aminoadenin; an 8-thioladenin; an 8-thioalkyladenin; an 8-hydroxyladenin; an 8-haloguanin; an 8-aminoguanin; an 8-thiolguanin; an 8-thioalkylguanin; an 8-hydroxylguanin; a 5-halouracil; a 5-bromouracil; a 5-trifluoromethyluracil; a 5-halocytosine; a 5-bromocytosine; a 5-trifluoromethylcytosine; a 5-substituted uracil; a 5-substituted cytosine; a 7-methylguanine; a 7-methyladenine; a 2-F-adenine; a 2-amino-adenine; an 8-azaguanine; an 8-azaadenine; a 7-deazaguanine; a 7-deazaadenine; a 3-deazaguanine; a 3-deazaadenine; a tricyclic pyrimidine; a phenoxazine cytidine; a phenothiazine cytidine; a substituted phenoxazine cytidine; a carbazole cytidine; a pyridoindole cytidine; a 7-deazaguanosine; a 2-aminopyridine; a 2-pyridone; a 5-substituted pyrimidine; a 6-azapyrimidine; an N-2, N-6 or O-6 substituted purine; a 2-aminopropyladenine; a 5-propynyluracil; and a 5-propynylcytosine.
24. The method of claim 1 , wherein the heterologous polypeptide comprises a transcriptional activator polypeptide or a transcription repressor polypeptide.
25. The method of claim 1 , wherein the heterologous polypeptide exhibits DNA-modifying activity.
26. The method of claim 25 , wherein the DNA modifying activity is selected from: methyltransferase activity, demethylase activity, DNA repair activity, DNA damage activity, deamination activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer forming activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photolyase activity, and glycosylase activity.
27. The method of claim 1 , wherein the heterologous polypeptide comprises an endosomolytic domain, an influenza HA domain, an IF2 domain, a GST domain, a GRPE domain, a 6×His tag, a hemagglutinin (HA) tag, or green fluorescent protein.
28. The method of claim 1 , wherein the cell is a bacterial cell.