Oligonucleotides containing high concentrations of guanine monomers

1. A method for coupling a nucleoside phosphoramidite during the synthesis of an oligonucleotide to a universal support, to a first nucleoside, or to an extending oligonucleotide, wherein said oligonucleotide comprises at least 30% guanine monomers, and wherein said oligonucleotide comprises a first region of 3 or more consecutive guanine monomers and a second region of 3 or more consecutive guanine monomers, said method comprising:

(i) generating a coupling solution, wherein said coupling solution comprises:

(a) at least one first solvent, wherein said at least one first solvent is a polar aprotic solvent, and wherein said at least one first solvent is not acetonitrile, wherein said coupling solution further comprises a second solvent, wherein said second solvent is acetonitrile, and wherein the ratio (v/v) of said at least one first solvent to said second solvent is between 3:1 and 2:5;

(b) an activating reagent; and

(c) said nucleoside phosphoramidite;

wherein the concentration of said nucleoside phosphoramidite in said coupling solution is at least 0.03 M; and

(ii) contacting said coupling solution with said universal support, with said first nucleoside, or with said extending oligonucleotide.

2. The method of claim 1 , wherein said at least one first solvent is selected from the group consisting of:

(a) sulfolane;

(b) 1-methylpyrrolidin-2-one;

(c) N,N-dimethylacetamide;

(d) tetramethylurea; and

(e) dimethylsulfoxide (DMSO).

3. The method of claim 1 , wherein the concentration of said nucleoside phosphoramidite in said coupling solution is 0.03 to 0.30 M.

4. The method of claim 1 , wherein the ratio (v/v) of said at least one first solvent to said second solvent is 1:1.

5. The method of claim 1 , wherein said first nucleoside and/or said extending oligonucleotide is immobilized on a support.

6. The method of claim 1 , wherein said support is a polystyrene support, wherein said polystyrene support is cross linked by divinylbenzene.

7. The method of claim 1 , wherein said oligonucleotide comprises a first region of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive guanine monomers.

8. The method of claim 7 , wherein said oligonucleotide comprises a second region of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive guanine monomers.

9. The method of claim 8 , wherein said first region is located at the 3′-terminus of said oligonucleotide and/or wherein said second region is located at the 5′-terminus of said oligonucleotide.

10. The method of claim 1 , wherein said oligonucleotide comprises 10 to 50 nucleotide monomers.

11. The method of claim 1 , wherein said oligonucleotide comprises a nucleotide sequence selected from the group consisting of:

(a) 

(SEQ ID NO: 3)

GGGGACGATCGTCGGGGGG;

(b) 

(SEQ ID NO: 4)

GGGGGACGATCGTCGGGGGG;

(c) 

(SEQ ID NO: 5)

GGGGGGACGATCGTCGGGGGG;

(d) 

(SEQ ID NO: 6)

GGGGGGGACGATCGTCGGGGGG;

(e) 

(SEQ ID NO: 7)

GGGGGGGGACGATCGTCGGGGGGG;

(f) 

(SEQ ID NO: 8)

GGGGGGGGGACGATCGTCGGGGGGGG;

(g) 

(SEQ ID NO: 9)

GGGGGGGGGGACGATCGTCGGGGGGGGG;

(h) 

(SEQ ID NO: 10)

GGGGGGGGGGGACGATCGTCGGGGGGGGGG;

and

(i) 

(SEQ ID NO: 11)

GGGGGGCGACGACGATCGTCGTCGGGGGGG.

12. The method of claim 1 , wherein said nucleoside phosphoramidite is coupled to an extending oligonuclotide.

13. A method for producing an oligonucleotide, wherein said oligonucleotide comprises at least 30% guanine monomers, and wherein said oligonucleotide comprises a first region of 3 or more consecutive guanine monomers and a second region of 3 or more consecutive guanine monomers, said method comprising

(i) coupling a nucleoside phosphoramidite to a first nucleoside; wherein said coupling comprises the method of claim 1 ;

(ii) generating an extending oligonucleotide by oxidizing the product of step (i);

(iii) coupling a nucleoside phosphoramidite to the product of step (ii) after deprotection; wherein said coupling comprises the method of claim 1 ;

(iv) generating an extending oligonucleotide by oxidizing the product of step (iii); and

(v) repeating steps (iii) and (iv) until said extending oligonucleotide comprises the sequence of said oligonucleotide.

14. The method of claim 13 , wherein said method further comprises the step of purifying said oligonucleotide under denaturing conditions, wherein said denaturing conditions are characterized by a pH of 10 to 14.

15. The method of claim 14 , wherein said purifying is performed by anion-exchange chromatography.

16. The method of claim 14 , wherein said oligonucleotide comprises a nucleotide sequence selected from the group consisting of:

(a) 

(SEQ ID NO: 3)

GGGGACGATCGTCGGGGGG;

(b) 

(SEQ ID NO: 4)

GGGGGACGATCGTCGGGGGG;

(c) 

(SEQ ID NO: 5)

GGGGGGACGATCGTCGGGGGG;

(d) 

(SEQ ID NO: 6)

GGGGGGGACGATCGTCGGGGGG;

(e) 

(SEQ ID NO: 7)

GGGGGGGGACGATCGTCGGGGGGG;

(f) 

(SEQ ID NO: 8)

GGGGGGGGGACGATCGTCGGGGGGGG;

(g) 

(SEQ ID NO: 9)

GGGGGGGGGGACGATCGTCGGGGGGGGG;

(h) 

(SEQ ID NO: 10)

GGGGGGGGGGGACGATCGTCGGGGGGGGGG;

and

(i) 

(SEQ ID NO: 11)

GGGGGGCGACGACGATCGTCGTCGGGGGGG.

17. The method of claim 1 , wherein said coupling solution comprises exactly one of said at least one first solvent.

18. The method of claim 1 , wherein the ratio (v/v) of said at least one first solvent to said second solvent is between 2:1 and 2:5.

19. The method of claim 1 , wherein the ratio (v/v) of said at least one first solvent to said second solvent is between 2:1 and 1:1.

20. The method of claim 1 , wherein said activating reagent is selected from the group consisting of:

(a) 4,5-dicyanoimidazole (DCI);

(b) 5-ethylthio-1H-tetrazole (ETT);

(c) 5-benzylthio-1H-tetrazole (BTT); and

(d) 5-(3.5-bis-trifluoromethyl)phenyl-1H-tetrazole (Activator 42).