IP Library Patent Application 14777059
Patent Application
App. No. 14/777,059

CHARACTERIZATION OF MRNA MOLECULES

Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US None
App. No.
14/777,059
Abstract

The present invention describes methods for the characterization of mRNA molecules during mRNA production. Characterizing mRNA includes processes such as oligonucleotide mapping, reverse transcriptase sequencing, charge distribution analysis, and detection of RNA impurities. Oligonucleotide mapping includes using an RNase to digest antisense duplexes from an RNA transcript, and then subjecting the digested RNA to reverse phase HPLC, anion exchange HPLC, and/or mass spectrometry analysis. Reverse transcriptase sequencing involves reverse transcription of an RNA transcript followed by DNA sequencing. Charge distribution analysis can comprise procedures such as anion exchange HPLC, or capillary electrophoresis. Detection of impurities includes detecting short mRNA transcripts, RNA-RNA hybrids, and RNA-DNA hybrids.

Claims (77)

1 . A method for characterizing an RNA transcript, comprising:

obtaining the RNA transcript; and

characterizing the RNA transcript using a procedure selected from the group consisting of oligonucleotide mapping, reverse transcriptase sequencing, charge distribution analysis, and detection of RNA impurities, wherein characterizing comprises determining the RNA transcript sequence, determining the purity of the RNA transcript, or determining the charge heterogeneity of the RNA transcript.

2 . The method of claim 1 , wherein the RNA transcript is the product of in vitro transcription using a non-amplified DNA template.

3 . The method of claim 1 , wherein the procedure is oligonucleotide mapping comprising:

contacting the RNA transcript with a plurality of nucleotide probes under conditions sufficient to allow hybridization of the nucleotide probes to the RNA transcript to form duplexes, wherein each of the nucleotide probes comprises a sequence complementary to a different region of the RNA transcript;

contacting the duplexes with an RNase under conditions sufficient to allow RNase digestions of the duplexes to form reaction products;

analyzing the reaction products using a procedure selected from the group consisting of reverse phase high performance liquid chromatography (RPHPLC), anion exchange HPLC (AEX), and RP-HPLC coupled to mass spectrometry (MS); and

using the analysis of the reaction products to determine the sequence of the RNA transcript, thereby characterizing the RNA transcript.

4 . The method of claim 3 , wherein the RNase is RNase H or RNase T1.

5 . The method of claim 3 , wherein the nucleotide probes are between 10 and 40 nucleotides in length.

6 . The method of claim 3 , wherein the nucleotide probes are between 15 and 30 nucleotides in length.

7 . The method of claim 5 or 6 , wherein the nucleotide probes comprise at least 8 deoxynucleotides.

8 . The method of claim 3 , wherein at least one of the nucleotide probes comprises a region that is complementary to a region adjacent to the poly-A tail of the RNA transcript.

9 . The method of claim 3 , wherein the nucleotide probes are complementary to regions no more than 50 nucleotides apart along the RNA transcript.

10 . The method of claim 3 , wherein the RNA transcript is a full length RNA transcript.

11 . The method claim 3 , wherein the RNA transcript comprises chemically modified ribonucleotides.

12 . The method of claim 3 , wherein the RNA transcript is between 100 and 10,000 nucleotides in length.

13 . The method of claim 3 , wherein the RNA transcript is between 600 and 10,000 nucleotides in length.

14 . The method of claim 3 , wherein the RNA transcript is between 700 and 3,000 nucleotides in length.

15 . The method of claim 1 , wherein the procedure is reverse transcriptase sequencing comprising:

contacting the RNA transcript with a reverse transcriptase, a set of primers, and deoxyribonucleotides to obtain one or more cDNA samples;

contacting the one or more cDNA samples with a second set of primers under conditions sufficient to allow peR to occur, wherein the cDNA sample is a template for obtaining a product comprising amplified cDNA;

analyzing the product using a DNA sequencing procedure; and

using the analysis of the product to determine the sequence of the RNA transcript, thereby characterizing the RNA transcript.

16 . The method of claim 15 , wherein the DNA sequencing procedure comprises Sanger sequencing.

17 . The method of claim 15 , wherein the DNA sequencing procedure comprises bidirectional sequencing.

18 . The method of claim 15 , wherein the primers are complementary to the untranslated regions of mRNA.

19 . The method of claim 15 , wherein the primers are selected from the group having sequences comprising: CGTCGAGCTGCAACGTG, CGTCCTGTCCGTCGCAG, TTTTTTTCTTCCTACTCAGGC, and GAAATATAAGAGCCACCATGG.

20 . The method of claim 15 , wherein the RNA transcript is a full length RNA transcript.

21 . The method of claim 15 , wherein the RNA transcript comprises chemically modified ribonucleotides.

22 . The method of claim 15 , wherein the RNA transcript is between 100 and 10,000 nucleotides in length.

23 . The method of claim 15 , wherein the RNA transcript is between 600 and 10,000 nucleotides in length.

24 . The method of claim 15 , wherein the RNA transcript is between 700 and 3,000 nucleotides in length.

25 . The method of claim 1 , wherein the procedure is charge distribution analysis comprising a second procedure selected from the group consisting of: anion exchange HPLC (AEX) and capillary electrophoresis.

26 . The method of claim 25 , wherein the capillary electrophoresis is capillary gel electrophoresis.

27 . The method of claim 25 , wherein the RNA transcript is between 100 and 10,000 nucleotides in length.

28 . The method of claim 25 , wherein the RNA transcript is between 600 and 10,000 nucleotides in length.

29 . The method of claim 25 , wherein the RNA transcript is between 700 and 3,000 nucleotides in length.

30 . The method of claim 25 , wherein the RNA transcript is a full length RNA transcript.

31 . The method of claim 25 , wherein the RNA transcript comprises chemically modified ribonucleotides.

32 . The method of claim 25 , wherein the second procedure is AEX comprising:

contacting a sample comprising the RNA transcript with an ion exchange sorbent comprising a positively-charged functional group linked to solid phase media, the sample delivered with at least one mobile phase, wherein the RNA transcript in the sample binds the positively-charged functional group of the ion exchange sorbent;

eluting from the ion exchange sorbent a portion of the sample comprising the RNA transcript and one or more separate portions of the sample comprising any impurities;

analyzing at least one aspect of the portion of the sample comprising the RNA transcript and the one or more separate portions of the sample comprising the impurities, wherein the at least one aspect is selected from the group consisting of charge heterogeneity of the RNA transcript, mass heterogeneity of the RNA transcript, process intermediates, impurities, and degradation products; and

using the analysis of the at least one aspect of the portion of the sample comprising the RNA transcript and the one or more separate portions of the sample comprising the impurities to determine the charge heterogeneity of the RNA transcript, thereby characterizing the RNA transcript.

33 . The method of claim 32 , wherein the sample is delivered under denaturing conditions.

34 . The method of claim 33 , wherein the denaturing conditions comprise contacting the sample with urea.

35 . The method of claim 32 , wherein the at least one mobile phase is a TrisEDTA-acetonitrile buffered mobile phase.

36 . The method of claim 32 , wherein the at least one mobile phase comprises two Tris-EDTA-acetonitrile buffered mobile phases.

37 . The method of claim 32 , wherein the at least one mobile phase comprises a chaotropic salt.

38 . The method of claim 37 , wherein the chaotropic salt is sodium perchlorate.

39 . The method of claim 25 , wherein the second procedure is capillary gel electrophoresis comprising:

delivering a sample comprising the RNA transcript into a capillary with an electrolyte medium;

applying an electric field to the capillary that causes the RNA transcript to migrate through the capillary, wherein the RNA transcript has a different electrophoretic mobility than any impurities such that the RNA transcript migrates through the capillary at a rate that is different from a rate at which the impurities migrate through the capillary;

collecting from the capillary a portion of the sample comprising the RNA transcript and one or more separate portions of the sample comprising the impurities;

analyzing at least one aspect of the portion of the sample comprising the RNA transcript and the one or more separate portions of the sample comprising the impurities, wherein the at least one aspect comprises charge heterogeneity of the RNA transcript; and

using the analysis of the at least one aspect of the portions of the sample comprising the RNA transcript and the one or more separate portions of the sample comprising the impurities to determine the charge distribution of the RNA transcript and the impurities, thereby characterizing the RNA transcript.

40 . The method of claim 39 , wherein the electrophoretic mobility of the RNA transcript is proportional to a mass and an ionic charge of the RNA transcript and inversely proportional to frictional forces in the electrolyte medium.

41 . The method of claim 39 , wherein the sample is delivered under denaturing conditions.

42 . The method of claim 1 , wherein the procedure is detection of RNA impurities comprising: detecting short mRNA transcripts, detecting RNA-RNA and RNA-DNA hybrids, and detecting aberrant nucleotides.

43 . The method of claim 42 , wherein the RNA transcript is a full length RNA transcript.

44 . The method of claim 42 , wherein the RNA transcript comprises chemically modified ribonucleotides.

45 . The method of claim 42 , wherein the RNA transcript is between 100 and 10,000 nucleotides in length.

46 . The method of claim 42 , wherein the RNA transcript is between 600 and 10,000 nucleotides in length.

47 . The method of claim 42 , wherein the RNA transcript is between 700 and 3,000 nucleotides in length.

48 . The method of claim 42 , wherein detecting short mRNA transcripts comprises:

denaturing the RNA transcript; and

subjecting the denatured RNA transcript to HPLC analysis, whereby the HPLC analysis quantifies any short mRNA transcript impurities.

49 . The method of claim 48 , wherein the HPLC analysis comprises reverse phase HPLC.

50 . The method of claim 49 , wherein the reverse phase HPLC analysis is followed by tandem mass spectrometry, whereby the tandem mass spectrometry identifies any impurities.

51 . The method of claim 42 , wherein detecting RNA-RNA and RNA-DNA hybrids comprises:

subjecting the RNA transcript to treatment with urea and EDTA;

subjecting the treated RNA transcript to spin filtration, wherein the filtrate retains a product comprising the impurities;

analyzing the product using HPLC; and

using the analysis of the product to determine the purity of the RNA transcript, whereby the analysis comprises identification of any RNA-RNA and RNA-DNA hybrids in the product, thereby characterizing the RNA transcript.

52 . The method of claim 51 , wherein the HPLC analysis comprises a procedure selected from the group consisting of anion exchange-HPLC, ion pair reverse phase-HPLC, and electrospray ionization mass spectrometry.

Assignments (3)
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Oct 12, 2017
From: AXOLABS GMBH
To: MODERNATX, INC.
Reel/Frame 043851/0390 →
CHANGE OF NAME Recorded Sep 28, 2016
From: MODERNA THERAPEUTICS, INC.
To: MODERNATX, INC.
Reel/Frame 040168/0398 →
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Jan 28, 2016
From: RÖHL, INGO
To: AXOLABS GMBH
Reel/Frame 037608/0262 →