Multiple exon skipping compositions for DMD
View Patent ↗Provided are antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon skipping, and methods of use thereof to treat muscular dystrophy.
1. An antisense oligonucleotide of formula (I):
or a pharmaceutically acceptable salt thereof, wherein:
Z is 18;
R is H or —C(O)CH 3 , and
each B is adenine, guanine, thymine, or cytosine, which taken together form a base sequence that is 100% complementary to 20 consecutive bases of exon 44 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of ATAATGAAAACGCCGCCATTTCTCA (SEQ ID NO:8), and wherein the antisense oligonucleotide induces exon 44 skipping.
2. A pharmaceutical composition comprising:
(a) an antisense oligonucleotide of formula (I):
or a pharmaceutically acceptable salt thereof, wherein:
Z is 18;
R is H or —C(O)CH 3 , and
each B is adenine, guanine, thymine, or cytosine, which taken together form a base sequence that is 100% complementary to 20 consecutive bases of exon 44 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of ATAATGAAAACGCCGCCATTTCTCA (SEQ ID NO:8), and wherein the antisense oligonucleotide induces exon 44 skipping; and
(b) a pharmaceutically acceptable carrier.
3. An antisense oligonucleotide of formula (I):
or a pharmaceutically acceptable salt thereof, wherein:
Z is 19;
R is H or —C(O)CH 3 , and
each B is adenine, guanine, thymine, or cytosine, which taken together form a base sequence that is 100% complementary to 21 consecutive bases of exon 44 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of ATAATGAAAACGCCGCCATTTCTCA (SEQ ID NO:8), and wherein the antisense oligonucleotide induces exon 44 skipping.
4. A pharmaceutical composition comprising:
(a) an antisense oligonucleotide of formula (I):
or a pharmaceutically acceptable salt thereof, wherein:
Z is 19;
R is H or —C(O)CH 3 , and
each B is adenine, guanine, thymine, or cytosine, which taken together form a base sequence that is 100% complementary to 21 consecutive bases of exon 44 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of ATAATGAAAACGCCGCCATTTCTCA (SEQ ID NO:8), and wherein the antisense oligonucleotide induces exon 44 skipping; and
(b) a pharmaceutically acceptable carrier.