Methods of detection and removal of rhabdoviruses from cell lines
The present disclosure relates to compositions, methods, mixtures, and kits for detecting the presence of and for removing, a virus from a product produced in an insect cell. The disclosure also relates to proteins, peptides, polypeptides, drug substances, biological products, vaccine antigens, and virus-like particles that are produced in an insect cell and that are free or substantially free of a virus. The disclosure also relates to compositions, methods, assays, and kits for detecting a rhabdovirus in a sample.
1. A method for detecting a virus comprising detecting a nucleic acid sequence comprising at least 50 contiguous nucleotides of SEQ ID NO: 1 or the reverse complement sequence of SEQ ID NO: 1.
2. The method of claim 1 , wherein the method comprises using one or more primers and one or more labeled probes in a PCR assay.
3. The method of claim 2 , wherein the method comprises using a forward primer having a sequence according to SEQ ID NO: 2 (TCTGTATTATGGGTTTGATCAGCTAAG), and a reverse primer having a sequence according to SEQ ID NO: 3 (CTCGCTGCTGAGCGGTTT).
4. The method of claim 3 , wherein the nucleotide sequence of the labeled probe is according to SEQ ID NO: 4 (AGGATTGGAGAATTATAC).
5. The method of claim 1 , wherein the method has a sensitivity level of between about 2 molecules of RNA and about 20 molecules of RNA.
6. A method for detecting particle-associated Sf9 rhabdovirus in a sample, the method comprising the following steps:
(i) treating the sample with RNase;
(ii) inactivating the RNase and disrupting particles in the sample;
(iii) detecting the presence or absence of Sf9 rhabdovirus RNA in the RNase-treated sample by RT-PCR;
wherein the presence of Sf9 rhabdovirus RNA in the RNase-treated sample indicates that the detected Sf9 rhabdovirus is aggregated onto or packaged within particles in the sample.
7. The method of claim 6 , wherein the RNase is RNase A.
8. The method of claim 6 , wherein the RT-PCR is conducted using a forward primer having a sequence according to SEQ ID NO: 2, a reverse primer having a sequence according to SEQ ID NO: 3, and a probe having a sequence according to SEQ ID NO: 4.
9. The method of claim 6 , wherein step (ii) is conducted using a chaotropic agent.
10. The method of claim 6 , further comprising detecting the presence or absence of rhabdovirus RNA in the sample by RT-PCR prior to treatment of the sample with RNase.
11. A method for detecting replication competent Sf9 rhabdovirus in a sample, the method comprising incubating the sample with a Spodoptera exigua cell line, passaging the cell line at least once following incubation with the sample, and detecting the presence or absence of Sf9 rhabdovirus RNA at the following time-points: after incubating the cell line with the sample and after each passage of the cells;
wherein an increase in the level of Sf9 rhabdovirus RNA signal after at least one of the one or more passages relative to the level of Sf9 rhabdovirus RNA signal detected immediately after incubation of the cell line with the sample indicates that the Sf9 rhabdovirus is present in the sample and is capable of replication.
12. A method for detecting the presence or absence of replication competent particle-associated SD rhabdovirus in a sample, the method comprising:
(i) treating the sample with RNase;
(ii) inactivating the RNase and disrupting particles in the sample;
(iii) detecting the presence or absence of Sf9 rhabdovirus RNA in the RNase treated sample by RT-PCR;
(iv) incubating the RNase-treated sample with a Spodoptera exigua cell line;
(v) passaging the cell line at least once;
(vi) purifying total RNA from the cell line at the following time points: after incubation with the RNase treated sample, and after each of the at least one cell passages; and
(vii) detecting Sf9 rhabdovirus RNA in the total RNA from each time point by RT-PCR;
wherein an increase in the level of Sf9 rhabdovirus RNA detected after at least one passage relative to the level of Sf9 rhabdovirus RNA detected immediately following incubation of the cell line with the RNase-treated sample indicates that the Sf9 rhabdovirus is capable of replication.
13. The method of claim 12 , wherein the RNase is RNase A.
14. The method of claim 12 , wherein the RT-PCR is conducted using a forward primer having a sequence according to SEQ ID NO: 2, a reverse primer having a sequence according to SEQ ID NO: 3, and a probe having a sequence according to SEQ ID NO: 4.
15. The method of claim 12 , wherein step (ii) is conducted using a chaotropic agent.
16. The method of claim 12 , further comprising detecting the presence or absence of Sf9 rhabdovirus RNA in the sample by RT-PCR prior to treatment of the sample with RNase.
17. The method of claim 12 , wherein the sample is a drug substance, and wherein the method is used in a release assay for the drug substance.
18. A composition comprising S. exigua cells and a rhabdovirus, wherein the rhabdovirus comprises a sequence having at least 70% homology to SEQ ID NO: 1.
19. The composition of claim 18 , wherein the rhabdovirus comprises a sequence according to SEQ ID NO: 1.