TYRP1, a natural miRNA sponge, and its use in managing human melanoma aggressiveness
View Patent ↗The present invention relates to methods and reagents for the treatment of melanoma and/or of metastatic melanoma that directly or indirectly target TYRP1 RNA transcript. The invention also relates to methods for predicting if a melanoma patient will be therapeutically responsive to such methods of treatment and reagents, and to methods for assessing the effectiveness of such methods of treatment and reagents. The invention further relates to a combination of biological markers that allows the prediction of melanoma patients' survival irrespective of the treatment administered.
1. A method for treating melanoma in a subject or for treating, preventing or delaying metastatic melanoma in a subject, comprising a step of administering to said subject a therapeutically effective amount of a micro-RNA inhibitor, wherein the micro-RNA inhibitor is a miR-16 target site blocker that binds to a sequence selected from the group consisting of SEQ ID NO: 9 (AGAAAAUUAAUUAUGUGUAGUUAU), SEQ ID NO: 10 (UGCCUGUGUUUGCCACUGUGUUUCCCUGCC), and SEQ ID NO: 11 (UCCAAUCACUGUGCUU).
2. The method according to claim 1 , further comprising a step of administering to said subject a therapeutically effective amount of a miR-155 target site blocker that binds to SEQ ID NO: 8.
3. The method according to claim 2 , wherein the miR-155 target site blocker is miR-3123.