Agents useful in treating facioscapulohumeral muscular dystrophy
The invention teaches antisense agents and RNA interference agents useful for treating diseases and conditions the treatment of which can benefit from reducing the expression of double homeobox 4 and/or double homeobox 4c, more particularly facioscapulohumeral muscular dystrophy. Further elaborated are methods, uses and further products employing such agents.
1. An antisense agent, or pharmaceutically acceptable salt thereof, wherein the agent is 25 nucleotides in length and comprises the sequence GGGCAUUUUAAUAUAUCUCUGAACU (SEQ ID NO: 65), in which U bases are T bases, and wherein the antisense agent is a phosphorodiamidate morpholino oligomer.
2. The antisense agent according to claim 1 , wherein the antisense agent is conjugated to a polyethylene glycol chain.