Angiopoietin-like 3 (ANGPTL3) iRNA compositions and methods of use thereof
View Patent ↗The invention relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the ANGPTL3 gene, as well as methods of inhibiting expression of ANGPTL3 and methods of treating subjects having a disorder of lipid metabolism, such as hyperlipidemia or hypertriglyceridemia, using such dsRNA compositions.
1. A double-stranded ribonucleic acid (dsRNA) for inhibiting expression of Angiopoietin-like 3 (ANGPTL3), wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5′- AAUAAAAAGAAGGAGCUUAAUUG - 3′ (SEQ ID NO:468).
2. The dsRNA of claim 1 , wherein said dsRNA comprises at least one modified nucleotide.
3. The dsRNA of claim 2 , wherein at least one of said modified nucleotides is selected from the group consisting of a 2′-O-methyl modified nucleotide, a 2′-fluoro modified nucleotide, a nucleotide comprising a 5′-phosphorothioate group, and a terminal nucleotide linked to a cholesteryl derivative or a dodecanoic acid bisdecylamide group.
4. The dsRNA of claim 1 , wherein the region of complementarity is at least 17 nucleotides in length.
5. The dsRNA of claim 1 , wherein each strand is no more than 30 nucleotides in length.
6. The dsRNA of claim 1 , wherein at least one strand comprises a 3′ overhang of at least 1 nucleotide.
7. The dsRNA of claim 1 , further comprising a ligand.
8. A cell containing the dsRNA of claim 1 .
9. A pharmaceutical composition for inhibiting expression of an ANGPTL3 gene comprising the dsRNA of claim 1 .
10. A method of inhibiting ANGPTL3 expression in a cell, the method comprising:
(a) contacting the cell with the dsRNA of claim 1 ; and
(b) maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of an ANGPTL3 gene, thereby inhibiting expression of the ANGPTL3 gene in the cell.
11. The method of claim 10 , wherein said cell is within a subject.
12. A method of treating a subject having a disorder that would benefit from reduction in ANGPTL3 expression, comprising administering to the subject a therapeutically effective amount of the dsRNA of claim 1 , thereby treating said subject.
13. The method of claim 12 , wherein the disorder is a disorder of lipid metabolism.
14. A method of inhibiting the expression of ANGPTL3 in a subject, the method comprising administering to said subject a therapeutically effective amount of the dsRNA of claim 1 , thereby inhibiting the expression of ANGPTL3 in said subject.
15. The dsRNA of claim 1 , wherein the region of complementarity is between 19 and 21 nucleotides in length.
16. The dsRNA of claim 7 , wherein the ligand is conjugated to the 3′ end of the sense strand of the dsRNA.
17. The dsRNA of claim 16 , wherein the ligand is an N-acetylgalactosamine (GalNAc) derivative.
18. The dsRNA of claim 17 , wherein the ligand is
19. The dsRNA of claim 2 , wherein said modified nucleotide is a 2′-O-methyl or a 2′-fluoro modified nucleotide.
20. The dsRNA of claim 1 , wherein said dsRNA further comprises at least one phosphorothioate or methylphosphonate internucleotide linkage.
21. The dsRNA of claim 20 , wherein the phosphorothioate or methylphosphonate internucleotide linkage is at the 3′-terminus of one strand.
22. The dsRNA of claim 20 , wherein the phosphorothioate or methylphosphonate internucleotide linkage is at the 5′-terminus of one strand.
23. The dsRNA of claim 20 , wherein the phosphorothioate or methylphosphonate internucleotide linkage is at the both the 5′- and 3′-terminus of one strand.
24. The dsRNA of claim 1 , wherein the region of complementarity consists of one of the antisense nucleotide sequences selected from the group consisting of
(SEQ ID NO: 468)
5′-AAUAAAAAGAAGGAGCUUAAUUG-3′;
(SEQ ID NO: 450
5′-AAAAAGAAGGAGCUUAAUUGUGA-3′;
(SEQ ID NO: 452)
5′-AAAGAAGGAGCUUAAUUGUGAAC-3′;
(SEQ ID NO: 455)
5′-UAAAAAGAAGGAGCUUAAUUGUG-3′;
(SEQ ID NO: 458)
5′-AUAAAAAGAAGGAGCUUAAUUGU-3′;
and
(SEQ ID NO: 125)
5′-AAGAAGGAGCUUAAUUGUG-3′.
25. The dsRNA of claim 1 , wherein the sense and antisense strands comprise nucleotide sequences selected from the group consisting of
(SEQ ID NO: 283)
5′-AUUAAGCUCCUUCUUUUUAUU-3′
and
(SEQ ID NO: 468)
5′-AAUAAAAAGAAGGAGCUUAAUUG-3′;
(SEQ ID NO: 265)
5′-ACAAUUAAGCUCCUUCUUUUU-3′
and
(SEQ ID NO: 450
5′-AAAAAGAAGGAGCUUAAUUGUGA-3′;
(SEQ ID NO: 267)
5′-UCACAAUUAAGCUCCUUCUUU-3′
and
(SEQ ID NO: 452)
5′-AAAGAAGGAGCUUAAUUGUGAAC-3′;
(SEQ ID NO: 270)
5′-CAAUUAAGCUCCUUCUUUUUA-3′
and
(SEQ ID NO: 455)
5′-UAAAAAGAAGGAGCUUAAUUGUG-3′;
(SEQ ID NO: 273)
5′-AAUUAAGCUCCUUCUUUUUAU-3′
and
(SEQ ID NO: 458)
5′-AUAAAAAGAAGGAGCUUAAUUGU-3′;
and
(SEQ ID NO: 63)
5′-CACAAUUAAGCUCCUUCUU-3′
and
(SEQ ID NO: 125)
5′-AAGAAGGAGCUUAAUUGUG-3′.
26. The dsRNA of claim 25 , wherein the sense and antisense strands comprise nucleotide sequences selected from the group consisting of
(SEQ ID NO: 653)
5′-AfuUfaAfgCfuCfCfUfuCfuUfuUfuAfuUf-3′
and
(SEQ ID NO: 838)
5′-aAfuAfaAfaAfgAfaggAfgCfuUfaAfusUfsg-3′;
(SEQ ID NO: 635)
5′-AfcAfaUfuAfaGfCfUfcCfuUfcUfuUfuUf-3′
and
(SEQ ID NO: 820)
5′-aAfaAfaGfaAfgGfagcUfuAfaUfuGfusGfsa-3′;
(SEQ ID NO: 637)
5′-UfcAfcAfaUfuAfAfGfcUfcCfuUfcUfuUf-3′
and
(SEQ ID NO: 822)
5′-aAfaGfaAfgGfaGfcuuAfaUfuGfuGfasAfsc-3′;
(SEQ ID NO: 640)
5′-AfcCfcAfgCfaAfCfUfcUfcAfaGfuUfuUf-3′
and
(SEQ ID NO: 825)
5′-aAfaAfcUfuGfaGfaguUfgCfuGfgGfusCfsu-3′;
(SEQ ID NO: 643)
5′-AfaUfuAfaGfcUfCfCfuUfcUfuUfuUfaUf-3′
and
(SEQ ID NO: 828)
5′-aUfaAfaAfaGfaAfggaGfcUfuAfaUfusGfsu-3′;
and
(SEQ ID NO: 187)
5′-cAcAAuuAAGcuccuucuudTsdT-3′
and
(SEQ ID NO: 249)
5′-AAGAAGGAGCUuAAUUGUGdTsdT-3′,
wherein A, C, G, and U are ribose A, C, G or U; a, g, c and u are 2′-O-methyl (2′-OMe) A, U, C, or G; Af, Cf, Gf or Uf are 2′-fluoro A, G, C or U; dT is a deoxy-thymine; and s is a phosphorothioate linkage.
27. The pharmaceutical composition of claim 9 , further comprising a lipid formulation.
28. The method of claim 12 , wherein the subject is a human.
29. The method of claim 13 , wherein the disorder of lipid metabolism is hyperlipidemia or hypertriglyceridemia.
30. The method of claim 14 , wherein the subject is a human.
31. The method of claim 30 , wherein the human subject suffers from a disorder of lipid metabolism.
32. The method of claim 31 , wherein the disorder of lipid metabolism is hyperlipidemia or hypertriglyceridemia.
33. The method of claim 12 or 14 , wherein the administration of the dsRNA to the subject causes a decrease in one or more serum lipid and/or a decrease in ANGPTL3 protein accumulation.
34. The method of claim 12 or 14 , wherein the dsRNA is administered to the subject at a dose of about 0.01 mg/kg to about 10 mg/kg or about 5 mg/kg to about 50 mg/kg.