Materials and methods for treatment of pulmonary arterial hypertension
The invention relates to the use of microRNA 96 and precursors and mimics thereof for the inhibition of vascular cell proliferation and/or vascular remodelling, and for the treatment of associated medical conditions such as pulmonary arterial hypertension (PAH).
1. A method for prophylaxis or treatment of pulmonary hypertension, comprising delivering to a target cell, or administering to a subject:
(a) miR-96, a mimic thereof, or a precursor of either; or
(b) a nucleic acid encoding miR-96, a mimic thereof, or a precursor of either.
2. A method for pulmonary vascular remodelling, comprising delivering to a target cell, or administering to a subject:
(a) miR-96, a mimic thereof, or a precursor of either; or
(b) a nucleic acid encoding miR-96, a mimic thereof, or a precursor of either.
3. A method according to claim 1 wherein said pulmonary hypertension is pulmonary arterial hypertension.
4. A method according to claim 1 wherein the target cell expresses the 5-HT1B receptor.
5. A method according to claim 1 wherein the target cell is a vascular cell.
6. A method according to claim 5 wherein the vascular cell is a vascular smooth muscle cell (VSMC) or a vascular endothelial cell.
7. A method according to claim 6 wherein the vascular cell is a pulmonary artery smooth muscle cell (PASMC) or pulmonary artery endothelial cell.
8. A method according to claim 1 wherein the target cell is a cell associated with the vasculature.
9. A method according to claim 8 wherein the target cell is an adventitial fibroblast or an immune cell.
10. A method according to claim 9 wherein the immune cell is a T lymphocyte, monocyte, macrophage or mast cell.
11. A method according to claim 1 wherein the precursor of miR-96 is pre-miR-96.
12. A method according to claim 11 wherein the pre-miR-96 has the sequence:
(hsa-pre-miR-96)
(SEQ ID NO: 3)
UGGCCGAU UUUGGCACUAGCACAUUUUUGCU UGUGUCUCUCCGCUCUGAG
CAAUCAUGUGCAGUGCCAAUAUGGGAAA
or
(mmu-pre-miR-96)
(SEQ ID NO: 4)
CCAGUACCAUCUGCUUGGCCGAU UUUGGCACUAGCACAUUUUUGCU UGUG
UCUCUCCGCUGUGAGCAAUCAUGUGUAGUGCCAAUAUGGGAAAAGCGGGC
UGCUGC,
wherein the mature miR-96 sequence is underlined.
13. A method according to claim 1 wherein the precursor of miR-96 is pri-miR96.
14. A method according to claim 1 wherein the miR-96 mimic comprises a guide strand which has the sequence:
U UUGGCA CUAGCACAUUUUUGCU
(SEQ ID NO: 1)
(wherein the seed sequence is underlined)
or which differs from that sequence at one or more positions outside the seed sequence.
15. A method according to claim 14 wherein the miR-96 mimic comprises:
(a) one or more modified sugar residues;
(b) one or more modified internucleoside linkages; or
(c) one or more modified bases.
16. A method according to claim 1 wherein the miR-96, mimic or precursor thereof is associated with a carrier, wherein the carrier is a pharmaceutically acceptable lipid or polymer, or a combination thereof.
17. A method according to claim 1 wherein the nucleic acid is delivered as naked DNA or in association with a carrier.
18. A method according to claim 1 wherein the nucleic acid is delivered via a viral vector.
19. A method according to claim 18 wherein the viral vector is an adenoviral or retroviral vector.
20. A method according to claim 19 wherein the retroviral vector is a lentiviral vector.